Transcript asmbl_40735

Sequence
Transcript Sequence for observation asmbl_40735 of TGE0005450:
CTTTTTCCGTCTCCCGCTGAGGCACCAAGAGGAGCTGTCGCCATGTCCGCCCATCTGCAATGGATGGTTGTACGGAACTGCTCCAGTTTCCTGATAAAGAGGAACAAGCAGACGTACAGCACCGAACCCAATAATCTGAAGGCCCGCAATTCCTTCCGCTACAACGGGCTGATTCACCGCAAGACGGTGGGCGTGGAGCCGGCAGCGGATGGCAAAGGCGTGGTGATCGTCATGAAGCGGAGATCCGGCCAGCGAAAGCCAGCCACCTCCTACGTGCGGACCACCATCAACAAGAATGCCCGGGCCACCCTCAGCAGCATCCGACACATGATCCGCAAAAACAAGTACCGCCCTGATCTGCGCATGGCGGCCATCCGCAGAGCCAGCGCCATCCTGCGCAGCCAGAAGCCCGTGATGGTGAAGAGGAAGCGGGCCCGCCCCACTAAGAGCTCCTGAGACACACACCTCCCCCCTCTGCTCCAAGAAATAAAGGTGTCAGCTGACCCTC