Transcript asmbl_19868

Sequence
Transcript Sequence for observation asmbl_19868 of TGE0000557:
CGGGGACCCCGGCAAGCCCGCGCACTTGGCAGGAGCTGTAGCTACCGCCGTCCGCGCCTCCAAGGTTTCACGGCTTCCTCAGCAGAGACTCGGGCTCGTCCGCCATGTCCGCCGCAGACGAGGTTGACGGGCTGGGCGTGGCCCGGCCGCACTATGGCTCTGTCCTGGATAATGAAAGACTTACTGCAGAGGAGATGGATGAAAGGAGACGTCAGAACGTGGCTTATGAGTACCTTTGTCATTTGGAAGAAGCGAAGAGGTGGATGGAAGCATGCCTAGGGGAAGATCTGCCTCCCACCACAGAACTGGAGGAGGGGCTTAGGAATGGGGTCTACCTTGCCAAACTGGGGAACTTCTTCTCTCCCAAAGTAGTGTCCCTGAAAAAAATCTATGATCGAGAACAGACCAGATACAAGGCGACTGGCCTCCACTTTAGACACACTGATAATGTGATTCAGTGGTTGAATGCCATGGATGAGATTGGATTGCCTAAGATTTTTTACCCAGAAACTACAGATATCTATGATCGAAAGAACATGCCAAGATGTATCTACTGTATCCATGCACTCAGTTTGTACCTGTTCAAGCTAGGCCTGGCCCCTCAGATTCAAGACCTATATGGAAAGGTTGACTTCACAGAAGAAGAAATCAACAACATGAAGACTGAGTTGGAGAAGTATGGCATCCAGATGCCTGCCTTTAGCAAGATTGGGGGCATCTTGGCTAATGAACTGTCAGTGGATGAAGCCGCATTACATGCTGCTGTTATTGCTATTAATGAAGCTATTGACCGTAGAATTCCAGCCGACACATTTGCAGCTTTGAAAAATCCGAATGCCATGCTTGTAAATCTTGAAGAGCCCTTGGCATCCACTTACCAGGATATACTTTACCAGGCTAAGCAGGACAAAATGACAAATGCTAAAAACAGGACAGAAAACTCAGAGAGAGAAAGAGATGTTTATGAGGAGCTGCTCACGCAAGCTGAAATTCAAGGCAATATAAACAAAGTCAATACATTTTCTGCATTAGCAAATATC