Transcript asmbl_40243

Sequence
Transcript Sequence for observation asmbl_40243 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCTTCATGGGATCGGTGCCAGACAGGGAGTGCTTGCCGCGACCTGCCCGTGAGCTGGGAGGTGGAGCGTTTCTTTCCTGGGGGTGGATGGACTCCCTGAGAAAGGGAGCTTTCTCGCCAGAGAGGAATGTAGGACGCCGAAGCAGCTCAAGGCAGAGGAAGGGGAGCTGGGGAGGGCGCAGCTGGCTGCAGAGCTGAGCCGTGTCCTGGTTGGCGGGCGTTAGGCCCCACTGACCCCTTGCCGGGCAACCGACAGTGTCCTGGGTCCTTCCCACTCCACTCTAAGATGAGAGAATTGGGACAGGTGATCTTCAGGGCCGTGGGGGACTCCGGTTCCTGACCCTGCACGGCTGCCTGGTGCGGGCCTGCCTGTGCTTCTGGGGCTCCCTGTGCAGCCTTCTCTTACGGCGTGGCTTTGCCAAGGAGGCCTCCTACCGGAGGGCTGAGCTCAGGACCCCTAGTGGCCCCCTCTCTGCCCATCAGCTCCCCCGGGGGTCTGCGGCCACGTCCCGTGGGCCTGTTCCCAGGAAGGGAGGGACCTCAGTTTCCGTCTCTGCGCCCACGTGGGCCTGATGGGGAGTGGTGACTCTGACATTGCCCAGGGTCTGCAGACGGAGTCACCGTTTTCCTGGAGAGAGGGCTCCCGCAGAGCTGGGCTTTCTCTGAGGCAGGCTTTCCCATCCTTGGACACCGCCCTACAGCTTAAGAGAGGAAGAAAACAAACGAGACAGGGAAGAGATGGGGGCTCAGTTCAAGTGAGCGCGTGGGAACGCGCCGCTCAGGGGGAAGAGCTGTCCTGCTGCTGCTGGCCTTGCGGGCCCCTCACCGGCGCTCTGTGGCTGGTGGAGGGCCGGGTGTCTCTCTGCTCCCTTCGCAGGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAG