Transcript asmbl_10958

Sequence
Transcript Sequence for observation asmbl_10958 of TGE0000055:
GTTTCGCACGGTCCAATAAGGGAGGGCGGCGTGGCCCGGCCTGGTAGCGACGAGGACGCGCCTGCGCAGAGGCGGCAGCACCACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCATCTGCCTGAGCGCCGTGGCCACGGCCACGGGGGCCGAGGGCAAAAGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTGGACCACTGTCCCATCAAATCGCGCAAAGGGGATGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAGTTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTTGGCACAGGCCAGGTCATCAAGGGCTGGGACCAGGGGCTGCTGGGGATGTGTGAGGGGGAAAAGCGCAAGCTGGTGATCCCATCCGAGCTAGGGTATGGAGAGCGGGGAGCTCCCCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAGCTGCTCAAAATAGAGCGACGAACTGAGCTGTAACCAGACTGGGGAGGGGCAGGGGGAGAGGCCCCCATCAGGGACCAGACTGTTCC