Transcript asmbl_48972

Sequence
Transcript Sequence for observation asmbl_48972 of TGE0005446:
CTTTGTCAGCCTGACCAAACCCTGATGAATTTTTGGCCCTTTGTAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTTAAGGATAGTGCCACAGGGCTCTCCAAGGGCTATGCCTTCTGTGAGTACGTGGACATCAACGTCACAGATCAGGCCATTGCGGGGCTGAATGGGATGCAGCTAGGGGACAAGAAGCTGCTTGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAATCAGACACCTGTGACCCTTCAAGTGCCCGGCCTGATGAGCTCTCAGGTGCAGATGGGCGGTCACCCAACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGATGAGGAGTATGAGGAGATTGTAGAGGACGTACGAGACGAGTGCAGCAAGTATGGGTTGGTCAAATCCATTGAAATTCCCCGCCCCGTGGACGGCGTCGAGGTGCCTGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGTCTAACCGGTCGCAAGTTCGCCAACAGAGTGGTGGTCACAAAATACTGTGACCCTGATTCTTACCACCGTCGGGACTTCTGGTAGAGGTGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGACTTTCCCCCCACCTGTCCCCTCCTCCTTTCCCCCCTCTTGAAGAAGATGGGCAGAGGAGTGACAGCCGAATGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGGGGTGGGGGGTGGG