Transcript asmbl_48971

Sequence
Transcript Sequence for observation asmbl_48971 of TGE0038201:
CTGGGAGGGGCGGGGCTTGGGGCTTGATTAGGTAGGCGACGGAGTGCCGGCGGGGGCCGGAAGTAGCCGAAGCCAGCGGCGGAAGTAGCCGGAGCGGGCGGGCGGCAAGGCGAGGCGAGAGCTGCACAGGGCCCTACGCGGCCGCCTAAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAACGAGAATAAACAAGAGCGGGACAAGGAGAATCGGCACAGGAAGCGTAGTCACAGTCGCTCTCGAAGCCGAGATCGAAAGCGCAGGAGCAGGAGCCGAGATCGGCGCAACCGGGACCAGCGCAGTGCCTCTCGGGATAGGAGACGACGAAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGATTGATTCGTTCTCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCACCGCCTGGCTTTGAGCACATCACCCCAATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACTGCCCTTCTCCCGACCATGACTCCTGATGGTCTGGCTGTGACCCCAACGCCAGTGCCTGTGGTTGGGAGCCAGATGACCAGACAGGCCAGACGTCTCTACGTGGGCAACATCCCTTTTGGCATTACTGAGTGAAATATTGTGGGGCTGAGATCCCTCGTAGCAACAAAAAGTTTGCTACCATCGTTGAAGGAGGCTATGATGGACTTCTTCAACGCCCAGATGCGCTTGGGAGGGTTGACTCAGGCCCCTGGCAACCCAGTCTTGGCTGTGCAGATAAATCAAGACAAGAATTTTGCCTTTTTGGAGTTCCGGTCAGTGGATGAGACGACCCAGGCCATGGCATTTGATGGCATCATCTTCCAGGGCCAGTCATTGAAGATTCGAAGGCCTCATGACTATCAGCCATTGCCTGGCATGTCAGAGAACCCCTCTGTTTATGTGCCTGGAGTTGTATCCACTGTAGTCCCAGATTCTGCCCACAAGCTGTTCATCGGGGGTTTGCCCAATTACCTAAATGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTTAAGGATAGTGCCACAGGGCTCTCCAAGGGCTATGCCTTCTGTGAGTACGTGGACATCAACGTCACAGATCAGGCCATTGCGGGGCTGAATGGGATGCAGCTAGGGGACAAGAAGCTGCTTGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAATCAGACACCTGTGACCCTTCAAGTGCCCGGCCTGATGAGCTCTCAGGTGCAGATGGGCGGTCACCCAACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGATGAGGAGTATGAGGAGATTGTAGAGGACGTACGAGACGAGTGCAGCAAGTATGGGTTGGTCAAATCCATTGAAATTCCCCGCCCCGTGGACGGCGTCGAGGTGCCTGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGTCTAACCGGTCGCAAGTTCGCCAACAGAGTGGTGGTCACAAAATACTGTGACCCTGATTCTTACCACCGTCGGGACTTCTGGTAGAGGTGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGACTTTCCCCCCACCTGTCCCCTCCTCCTTTCCCCCCTCTTGAAGAAGATGGGCAGAGGAGTGACAGCCGAATGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGGGGTGGGGGGTGGG