Transcript asmbl_40208

Sequence
Transcript Sequence for observation asmbl_40208 of TGE0005427:
CCGGGCTGTACTGGCGCCAGGCTCCACACGGCCGCACTGCGGACAGGCTGTGGGGAAAGGCAGCGTTCCCGCTTGGCCAGGACACTGTCACCCAAGGCATCTCACAGGACTTAAAAGTGTGCTGCTTGTGAGACTCAGTGCGGCGCGCTCCTCGTTCCCATGCCTCTCTGGGGCCTTTTCGATGGATTTAAGAGTTTGGGGAAACGTAACCGATCGGGAATGTTTCCTTCAGTGCCCAAAGGGGTCTCACCCTCTTTTCGGTAACAGAAACCATCATAGCCTTTGCCTGGGAGCCCAATGGCAGCAAGTTCGCGGTGCTGCACGGGGAGGCTCCTCGGATTTCGGTTTCCTTCTACCACGTGAAGAGCAACGGGAAGATCGAGCTCATCAAAATGTTTGACAAGCAGCAGGCCAATACCATCTTCTGGAGTCCCCAAGGACAGTTCGTAGTGTTGGCGGGTCTGAGGAGCATGAACGGCGCTTTGGCGTTTGTGGACACCTCAGACTGCACAGTCATGAACATCGCAGAACACTACATGGCCTCCGATGTGGAGTGGGACCCGACGGGGCGATACGTGGTCACCTCTGTGTCCTGGTGGAGCCATAAGGTGGACAACGCTTACTGGCTGTGGACTTTCCAAGGACGCCTTCTGCAGAAGAATAATAAAGACCGCTTTTGCCAGCTGCTGTGGAGACCTCGGCCCCCAACACTCCTGAGCCAGGATCAGATAAAGCAAATTAAAAAAGATCTGAAGAAATACTCCAAGATCTTTGAACAGAAGGATCGTTTGAGCCAGTCCAAAGCCTCCAAGGAACTGGTGGAGAGACGACGAACCATGATGGAAGATTTCCGAAAGTACCGGAAAATGGCCCAGGAACTCTACATGGAGCAGAAAAACGAACGTCTAGAACTGCGAGGAGGTGTGGACACCGATGAGCTGGACAGCAACGTGGACGACTGGGAGGAAGAGACCATCGAGTTTTTTGTCACTGAAGACATCATTCCTCTTGGGAGTCAGGAGTGATCTGAGACCGCCAGGGTAAGATCTCTCCTGCAGGATGGCTGGCATTCTGTCCAGAGCCTGCAGTTAGGGAGCGCGTTGTTTAAGGTGAGGGCGAAACCCAGCGCCATGCTCTCAAGGTTGTAAAGCCCTTGCGTGTGGGTTGTGACCAGCTCGATGCACACCGGATGTCAGGGCTGAGCCTTTTGTCAGAAAGTGCTCCAGGCACAGGCACAGCGTTTGCGCTTGGGTGAGAGC