Transcript asmbl_40195

Sequence
Transcript Sequence for observation asmbl_40195 of TGE0005420:
AGTGAAGAACAAGAAGCTGCTGCTCCTGGCTGTGTCCGAGTTGTGGCGGTGGCGGTGGCGTGCGGCCGGCGTGGGTGCGTGGCAGGCTGGCCGCAGCAGGGGACGTGTCTGCACTTCTAACCTCTGCCTCCCCGCATTGCTTCTCCTCCTGCAGTATGATTTGACGTCGCGAACATGGACTTTTCTCGGCTCCACATGTACACGCCGCCGCAGTGTGTGCCCGAGAACACTGGCTACACATACGCACTCAGTTCAAGCTATTCTTCCGATGCTCTGGACTTCGAGACTGAGCACAAGTTGGATCCCGTGTTTGATTCTCCAAGAATGTCCCGCCGTAGTTTGCGCCTGGTCACCACAGCGTACACCACCGATGGTGGCCAGGCTGGGGACATTCACTCCTGCGACAGCAGCATGGCCTCCCTGAAGGACAGAGCGGCCAGAGCAGCAAAGCAGCGCAGAGGCGCAGGGAAGCTGGCCTGGAGCGTGAACCACACGTCCGGAAAGGTCGCGGCTGGCCTGCAAGGTGCCGCTGGTCTGCGGCCTCCCGTGCTAGATGCGTCCCTGATCCGCGAGCAGACCAGAGTGGACCACTTCTGGGGTCTTGACGATGACGGAGATGTGAAAGGTGGAAGTAAGGCTGTCACTCAGGGAAATGGCGACGTGGCGGCGGACGCGGCCAGGAGCAACGGCTACACCTGCAGTGACTGCAGCCTGCTGTCCGAGCGCAGGAACACGCTCACCGCGTGCTCTGCCTCCCAGGGGACAGTGTCGCGGATCTACTCGAGGGACAGGAACCAAAAACGCGGCGCGTCTTTCTACACGGATAGGATTTTGTGGCTGGCCAAGTACGTTTCGTCATCTCTTTCATCATTGTTAGTTCAACTTTTTCAAGTGGTTTTAATGAAGCTCAATCGCGAATCAGAAAATTACAAATTGAAAAGTTACGAATCAAAAGATCGTGAATCAGAAAGCTATAACTCAAAAAGCCGTGAATCAAAAGCTCGGCCTGGCGACAGAGGGAGGATGGACGTGAAAGGCGTCCTCGGAGAGGACGGCCACCTCAGGGAGAATGGGGAGTCGTCGTGCGATGACTGTAAGGGGAAGCAGCGCCTTGAGACACAGCCAGCCAGCCACTGGCAGTCTTCCGGGCCATGGAGCGTGGCAGGGACCGTTGGGCACACCTTTTCTCAAGCAGGTCGCTTCTTGACGCAGACCCTGCAGAGGACCCGAGCGGCAGGGTGGTTTGTGTCGGAGACGGTGTTGTCGGTTCTTTGGTTGGCCATGGTGGCTCCAGGGAAGGCAGCCTCTGGAATATTCTGGTGGCTGGGGAGTGGCTGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACAAGGTGCCTTCGAAATATTTGCAAGCTTTTAATCTTGCTCATTCCACTGCTGCTTTTACTGGGTGCAGGCCTTTCACTCTGGGGCCAGGGCGGTCCCCTGTCGTTCCTGCCCGCGGTGAACTGGACACACGTGTACAGAGCGCAGAGGGCGGACGGCCCCGGGAGCACCTTCTCGCCTGACGGTCCCCGCCCGAGCCCACCCCTCGAGGCTGGTGATGGGACCGTTGGCTGGCGTCGGATGGGTGAAGTGGAAAGGTGGATGACGTCTTTGTCTGGACAGTGCCAGAGCCACGATGAGCGGCTCAGAGACTTGACAGCCTCGCTTCAGAAGCTGCAGATGCGCGTGGACCAGATGGACGGCGGCAGGGAGGGGGTGTCGTCCTTGGTGAGCCACGTGGTGAGCCAGCGTTTGAAGGAGATGAGTGCCGACGGACTCTTGGGCCCCAAGGCTGACCACGTGACCGCCCACCAAGACCATGGCGCACGCATCGCAAACCTGGAAGATGTTCTCGGAAAACTGACAGAAAAGTCTGAGGTCATCCAGAAGGAGCTAGAACAGACCAAGCAAAGGACAATGAGCGGGCTCGAGGAAGAGCAGCGCCTCCTGTCGGTGGTGAAGCAGCTGCAGCTGGAGCTGAGTCTCCTGAAATCAGAGCTGTCGCAGGGGCAGCATGTGACCCCCAGCTGCGAGCAGGGGGATGCCATCCACGAAAAGGTGGACGCCCGGGTCAGGGAGACGCTCGGGCTCCTGGTGTCGGACGGGCAGTGGGCCGGCGTGCTGGAAGGGCTGCTCCAGAAGCTGTCTTCGCAGTTTGTCGGCAAGGACGACTTACAGGTGTTGTTACGAGACTTGGAGCTGCGGATACTGAAGGAGGTGACCCACCGTGTTTCCGTGACAAAGCAGATCCCCACGTCTGAAACGATCATGTCTGCTGTGAACGACGCCGGGGTTTCTGGAATAACAGAAGCGCAAGCGCACGTCATTGTGAACAATGCATTGAAGCTCTATTCCCAGGACAAGACCGGCATGGTGGACTTTGCTCTGGAGTCCGGCGGCGGCAGCGTCCTGAGCACCCGCTGCTCCGAGACCTACGAGACCAGGACCGCGCTCGTCAGCCTGTTCGGGGTGCCGCTCTGGTACTTCTCCCAGTCGCCCCGCGTCGTGATCCAGCCTGACATGTACCCGGGGAATTGCTGGGCGTTCAGAGGCTCCCAGGGGTACCTGGTGGTGAGGCTGTCCATGAAGATCCACCCAACCAGCTTCGCCCTGGAGCACATCCCAAAGGCACTGTCGCCCACCGGCAACATCAGCAGCGCCCCCAAGGACTTCGCGGTCTACGGACTGGAAAATGAATACGAGGAAGAAGGGGAGCTGCTGGGCCAGTTTGTGTACGATCAGGAAGGGGAGTCGCTCCAGATGTTCCATGCTCCGAAAAGACCCGAACGAGCTTTCCAAATCGTGGAGCTTCGGGTTCTGTCCAACTGGGGCCATCCCGAGTACACGTGTCTCTACCGGTTCAGAGTCCACGGGGAGCCTATCAAGTAGGCCTCTCCTCGCTCCTCTTGTACATTCTGTATATACTGGGACAGCCCGAAACACTGGATCCTCCCTGAACGAGGCGTAGGACGGACAGCATGACGTCGTCTGTTAAATAAACGTTACTGACCGCCAGCAGCAGGACTGGGGATTGAAGCGGCGACGCCGTGCGCCCAGCTGGCCGTTGTGTCCGCGGGAAACACTGCATGTTGAGTGCTCGGGTTTACGGGGGCCGCTGGCAGCGGTGGCTTCGGAAATGCATTTGAATGTATGGTTCGCAAAGACACTTAACTTCGTTTTGGGGATTTGTTTTTAAACATAAAGCTCTTTATACCTGTCTTTCCTTGACGTCAGGAGCAAAGCAAATGAAGTTGAAAGGTTTGAAGTGTTCTCGAAACTTTCACCGGCCCTTTTAAAGGACTTTGAGGGGGTCGGGGGCGGGGGTTACCTTTTCAGTCCAGCATACGTATCTTTCAGGGAGAAACAATGTCACCAAGTTTCAGGGTTCCAAGCTCCTTTCCTTTAGGGTGGGGGTTTTCTTTTATTCAGTACCACTAGTTATTTTAAGTTGCCAGGTGGGGAAACGCCTAAAATGTGTTCTTCTGCTCAGTTTGCTCTACTTCTGAGAAAGATTTGCAAGGTCAGGGCTCAGCGTGCCGCTCTCCATGCGGGACCACGGGGGAGTTCGGTTTCGTTTCATTGCGGGTTGCAGTGGTTCTGACTGGAAGGGGGACAGTCCGGATCCAGACCCCGAGAAAGAGCTCTCAGGTCCGCCAGGCTCATCCCGTTGGGATCGCCCCGGAGTGTCCACTTCACAGCTCGAGTGGGAACTGAGGAATCCAACGGTTGGGTGTTTTCAGGTTGTCTTTTGAATTTGGCTGAAAAGCGAACACTAACGTGCTCCGGATCTCTCAGAGGCTCATGTTTTGAATCCACTGATGCGCTTATCAAAGGGGGACTGGTCAGTGCGGCGAATTCATAGAACCGTTAGGTCTCGTGACCATGACTTTCCTCACAGTGGCACTTTCTACTGGCTCTGGTGGGGATTTGCCTCTTAGGACGACCGTCAACCATTCTCCCTCAAGTCCTGCGAGTCTCATTTAGGTTATAATTAATATTTCATACTGAGACTGTTATACTGAGCAGACTTTATAAATGAGATGTCCACAAGGCACTTAAAGTGTTACAGATGTTTTACCTTAAAATTATTTAAGTTTTATTGGGTTAAGACAGTTTCTTGGTGTACCATAAATCCTGTATTTTTCAGAAAAAAAGATAAAATGATGGTGCTGACTGGTTTTCTGAAGAGTTTTATGTAAATTGCACAACAGTCCTCAAACATACAAAAACTACATAACAGAAAGTAGCATTTTTTCACTTACAATCAGAACTAATGCCTATGCAGTTAAGTTGGATACAATGTACACAGATGTTTCATATATTACGGGATAAATATATAAATCAAAATTTCCTATATTAAACAGTTGGGGAGTTGGGGTGGAAATATTTTGAATATTAATTTATTTTTAAAGATGCAAGATAGGACTTTGTGCAATGTATTTTTGTAAATGCTTTTCAAAATATTTGTCTTTGGTAGTCTTTCTTTTGCTGCCACCAAATTGATAAGATGCTATTGAAATGTTTAAATAAAGAGTTTTAATTTTTAAAAGTGCATGTGAAATTTCAAATGGATAATAAACAGTATATTTCTTTTCTCAAA