Transcript asmbl_40093

Sequence
Transcript Sequence for observation asmbl_40093 of TGE0005409:
CAGAGCCGCCTGTGGCCCCAGCTGTAAGGCTGCCTTTACCAGGGAAATGAAAGAGTCTTTTCACTCCCCGCTTCTTCCCTCCCCCTGCCAGGCCCAGCATCATCATCACTCCCATCTTCCTTCTGTGACTGCATCCTTCTTTTCTGGAAGGAAATCATAAGCAACCTGTCCAGGGAGGATTGCTCCGGAAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTGCTTCCTGGGTGAGTTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAATCCAGAAAGGCGCCTCTAAACTCAGAGAACGGATTCAACCAGAAGAAAAACCAGTGGAAGTCAGCCCGGCTGTGTCCAGGGGACTCCATATAGCAAAGCAGGCTACGGGAGGAGCAGCGAAAGTCAGTCAGTTCCTGGTTGACGGAGTTTGCACTGTAGCAAATTGTGTTGGAAAGGAACTAGCCCCACACGTCAAGAAGCATGGAAGCAAACTTGTTCCAGAATCTCTTAAAAAAGACAGAAATGGGAAGTCTCCCCTGGACGGTGCTATGGTCGTAGCAGCAAGTAGTGTTCAAGGATTTTCAACCGTCTGGCAGGGATTGGAATGTGCCGCCAAATGCATTGTTAACAACGTTTCAGCAGAAACAGTACAAACTGTCAGATACAAATACGGGCATACCGCGGGAGAAGCTACACACGATGCAGTAGATTCCGCCATCAATGTTGGTTTAACTGCCTATAACATTGACAACATTGGCATCAAAGCAATGGTGAAGAAAACTGCAAAACAAACCGGACAAACAATCCTTGAGGACTATAAAATACTTGATAATTCAAAGGGGGAGAATCTAGGAGGGGGAGCAAATGTAAACGTGAAAGGGGAGAAGGAGGAGCAGACAGAGGAACTAGAGAAGAAGGAGGCAAAGAAGAAAGGTAAATGATGAAAGGGCAGCGAATCACCTATACCAAAGCCTTAAAAGACGGATGCGACTGTGCTAAGAGGCAGATGTGGAATTCGCCATCGATTAACCAGTATTTTAACAAAGTATACATTTCTACAGAGTAACTGTTTCCATAAGCTTTATGGCATGTATTCTACTTACAAGGAAAATAATTGGTATTCTTTCATCTGGCCTTAGAAATATCCAGTTATATTCTCAGTAAGTTAATTTTTTCTAAATGTGGCTAAAGTATTTTTGCAGTTAAAGTAAGACTAATAATACATGCGCTATAAACCTCATTAAACCCAATATTAAACTATTTTTGTATTTGCTATCTTTCAGAAAGCAAAGTAGGAAATTATTATATATTTACATAATATTGGCATTTAGTAACCTTAGTTTTATTTGTAATGGGAAGGATAATTTAAAATACTGTTTCCTCTTTTTGCACTAATCGTGGATCTTTTTAAGTACTTGTTAGAATTTCCAGCATATAAGCTAAACAAAAATTGTATTCCTAAACTAAGAATTCTCAGATAACATTTAAAAGATGTTTTCAAAACAGGGAATGGTCTAGTCATGAAAAATAAAAAGTTCTATAAAATTATTTAGTAGCTTACCTCTTAGGAAATAGGATGGTCTTTTTGATTTAAAATGAATACAAATAGATTTTTAAGTTTTCTGGATTTAGACTGGCCTGGGGAATTTAGGGGTATGATTCCTATTGTATTAAAATTTGAAGTGACGATTATTTAGTCTATTATATCTACTTCTGTAAGTTTCCCCAAAAGGCTAAAATTTTATGAAAAAATGAGGATAAACAGTATTGAGTTTATGGATAGCAAATATATTTTTATTTTGGAATCAGTCATTGGAATTTTATATATTAAAAAGCCATTAAATTATTAGAAAAGGTTTTATTCATAATATGAAGATGTTAGGCTTACTCCTCGGTGGGTGGGCATAACAGTTTCTACTTTGGCAGAAGGCAGGATATTCACAGACCTTTAAGCTACAAATATGTAGGTAAATACCTGATGGCATTTTATTTTTGTTTACTGGTTTTAAAAGATTGGTATTGGTTTTCATAGCTATTGTCCACCCTAATATTTTTGAATCTCTAGTGGCTACTTAGTTTATTAGACCTTTTTTGAAACTGTCTAAATAATGCACTTTGTGAATGAATGAACTCTCTGAATTACCTGGCTGCAGATACTGTCATAGGCTTGCTTGTATTTTGGGAACACAATAGAATTGGTGGAGTCTTTCTGTAAGGCCAAGGATAATGGACTAGTTGTTAAAACGGAAATAAAATTGAATTGGT