Transcript asmbl_40064

Sequence
Transcript Sequence for observation asmbl_40064 of TGE0005406:
CCGCGGCGCTGGCCCGCTGAGCTAGTTCCTGCTGGGTCTGGGTCGCCGTCGCCGCCCGGGTCCTGTCGCCTGATGGTCCGCCTGTGAGGCGGGCTGCCGGCTGACGTCTCCTCGCGATGGAGCACATCCGTACGACCAAGGTTGAGCAAGTGAAATTACTTGACCGATTCAGTACCAGCAACAAGTCATTGACAGGGACACTGTATCTTACAGCCACACACCTGTTATTTATAGACTCTCATCAGAAGGAAACCTGGATTTTGCACCATCATATTGCCTCAGTAGAGAAACTGGCTCTGACGACTTCTGGGTGCCCACTTGTGATTCAGTGCAAGAACTTCAGGATTGTGCATTTCATTGTTCCCAGAGAAAGAGATTGCCATGACATTTACAACTCTTTGCTACAACTGTCAAAACAAGCAAAATATGAAGATCTCTACGCATTCTCTTATAATCCCAAACAAAACGATTCAGAACGACTGCAAGGCTGGCAGCTCATTGACCTCGCTAAGGAATACGAGAGGATGGGAGTGCCAAATTCAAACTGGCAGCTGTCGGATGCCAACCGAGAGTACAAGATTTGTGAAACTTATCCCAGAGAACTCTATGTTCCTCGAATAGCAAGCAAGCCAATCATCGTGGGCAGTTCCAAGTTCCGGAGCAAGGGGAGGTTCCCGGTGCTTTGCTACTATCATCAGCATAAGGAGGCTGCCATTTGTCGGTGTAGTCAGCCACTGTCAGGATTCAGTGCCCGGTGCCTGGAGGACGAACATTTGCTTCAAGCCATTAGTAAGGCCAACCCGGTCAACCGCTACATGTACGTCGTGGATACCAGGCCCAAACATCGCATGCAGAGCTGGTGGGCT