Transcript asmbl_46138

Sequence
Transcript Sequence for observation asmbl_46138 of TGE0038038:
GCGGGTCCGGAGGGAGGCGCACTTCCGGTGCCCTTTCTCCCGCGAGCTCTAAGGCCGCCGATCCTCGTGTGCAAGGCGAGGTCTGTAAGCTGGAGCGGGGCAGAGGCTGGCGGGCACCCCCTCCTGACCGCTGGTGCCGCCGCCGCCGCCTTCGGGAGGATCAGACATGGCCCAGAACTTGAAGGACTTAGCTGGACGCCTGCCCGCCGGGCCTCGGGGCATGGGCACGGCGCTGAAGCTGCTGCTGGGGGCCGGGGCGGTGGCCTACGGCGTCCGCGAATCCGTGTTCACCGTGGAAGGCGGTCATAGAGCCATCTTTTTTAATCGTATTGGTGGCGTGCAGCAGGACACGATCCTGGCCGAAGGCCTTCACTTCAGGATCCCCTGGTTCCAGTACCCCATCATCTATGACATTCGGGCCAGACCTCGAAAAATCTCCTCCCCCACAGGCTCCAAAGACCTGCAGATGGTGAACATCTCCCTGCGTGTGCTGTCCCGACCCAATGCCCAGGAGCTCCCCAGCATGTACCAGCGTCTAGGGCTGGACTATGAGGAGCGAGTGCTGCCGTCCATTGTTAATGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCGCAGCTGATCACCCAGCGGGCTCAGGTGTCCCTGTTGATCCGAAGAGAGCTGACAGAGCGCGCCAAGGACTTCAGCCTCATCCTGGATGATGTAGCTATCACAGAGCTGAGCTTCAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAGCAAGTGGCCCAGCAGGAAGCCCAGCGGGCCCAGTTTTTGGTGGAGAAAGCGAAGCAGGAACAGCGACAGAAGATTGTGCAGGCTGAGGGGGAGGCGGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAATCCTGGCTATATCAAGCTCCGAAAGATCCGGGCCGCCCAGAACATCTCTAAAACGATCGCCACATCACAGAACCGAATCTATCTCACAGCTGACAACCTTGTGCTGAATCTACAGGATGAAAGTTTTACTCGGGGAAGGTAAGTGGCTGCCTCCTTGCTATGGGGTCCTGGGGGCCATCTGCTTCCTGGACCTGCCCCTACACCCCCTTTCTCC