Transcript asmbl_45875

Sequence
Transcript Sequence for observation asmbl_45875 of TGE0034453:
TTCCGGTGCGCCGGACGCAGCTAGGCTGTACAGACGCGGGCACGCACACCAGCACGCACGCCCTCCTCTCGTGCGGCCGCGGTCGTTCCCGCGTCCACCAGCAGCGCTGTCGCTTCGGCAGAAATGCTGCGGGCCTGTCAGTTATCCGGCGTGACCGTCGCGGCCCAGAGTTGTCTGTGTGGGAAGTTCGTCCTCCGTCCACTACGACCATGCCGTAGATACTCCACTTCAAGCAGTTCTGGGTTGACTGCTGGTAAGATTGCTGGAGCTGGCCTTTTGTTCGTTGGTGGAGGGATTGGTGGCACTATCCTGTATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATCCCTTACTCAGACAAACTCTTTGGGATGGTTCTTGGTTCTGCGCCTTATACTGTTCCATTACCAAAGAAACCGGTTCAGTCTGGTCCACTAAAAATCTCCAGTGTATCAGAGGTGATGAAAGACTCCAAACTGCCTGTGGCACAGAGCCAGAAAACGAAGGGAGACACTCCAGCTTCAGCAGCAGGTGATACACTTTCGGTCCCGGCCCCTGCAGTTCAGCATGAGGACACTATAAAAACCGAATGTCCCAACACTAATGAAGGAAAATCTACGTCTGAAACCACAGCTCTAGCCAAGAGTTTAGAAGATGCTCTGAACCGGACTTCGTCTGTCACTCTGCAGACTATTACAGCCCAGAATGCTGCAGTTCAGGCTGTCAAGGCACACTCCAACATACTGAAAACAGCCATGGACAATTCTGAGATTGCAGGTGAGAAGAAGTCGGCCCAGTGGCGAACAGTGGAGGGTGCATTGAAGGAGCGAAGAAAGGCAGTTGATGAAGCTGCCGATGCCCTGCTCAAAGCAAAAGAAGAGTTAGAGAAGATGAAAACTATAATTGAAGATGCAAAGAAAAGAGAGATTGCTGGAGCCACCCCTCATATAACTGCTGCAGAGGGGAGACTTCACAACATGATAGTTGATCTGGATAACGTCGTCAAAAAGGTCCAGGCTGCTCAGTCAGAGGCAAAGGTGGTATCTCAGTATCATGAACTTGTGGTCCAAGCAAGAGATGACTTTAGAAAAGAGCTGGACAGTATCACTCCAGACATCACTCCTGGATGGAAAGGGATGAGTAAGTACAACTGATTCTGGCAAACTCTCTACTGATGACCTGAACTCACTCATTGCTCATGCCCATCGTCGCATTGATCAGCTCAACAGAGAGCTAGCACAACAGAAAGCCACAGAGAAGCAGCACATTGAGCTAGCCTTGGAAAAGCACAAGCTAGAAGAAAAGCGGACCTTTGACTCTGCAGTGGCAAAAGCATTGGAGCACCACAGAAGTGAAATTCAGGCTGAGCAGGACAGAAAGGTAGAAGAAGTCAGAGATGCCATGGAGAATGAAATGCGGACCCAACTTCGACGGCAGGCAGCTGCCCACACTGATCATTTACGAGATGTCCTCAAGGTGCAGGAACAGGAACTGAAGTATGAATTTGAACAGGGCCTGTCTGAGAAACTGTCTGAGCAAGAATTAGAGTTTCGTCGTCGCAGTCAAGAACAAATGGACAGCTTTACTCTGGACATAAATACTGCCTATGCCAGGTTGAGAGGGATTGAGCAGGCTGTTCAGAGTCATGCAGTTGCTGAAGAAGAAGCCAGAAAAGCCCACCAGCTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAATGCCTACCATCCCATTGGGGAGTGCAGTTGAGGCCATCAGAGTCAACTGTTCTGATAATGAATTTACCCAGGCTTTAACTGCAGCCATTCCTCCAGAGTCCCTGACCCGGGGGGTATACAGTGAAGAGACCCTAAGAGCCCGTTTCTATGCTGTTCAAAAACTAGCCCGAAGGGTAGCGATGATTGACGAAACCAGAAATAGCCTGTACCAATACTTCCTTTCCTACTTACAGTCCCTACTCCTGTTCCCGCCTAAGCAACTGAAGCCCCCGGCGGAGCTCTACCCTGAAGATATAAATACATTTAAATTGCTCTCATATGCCTCCTATTGTATTGAGCATGGTGACCTGGAGCTGGCAGCAAAGTTTGTCAATCAGCTCAAAGGGGAGTCCAGAAGAGTGGCACAGGACTGGCTGAAGGAGGCCCGAATGACCCTAGAAACTAAGCAGATAGTGGAGATCCTGACTGCATACGCCAGCGCCGTAGGAATAGGAACCACTCAAGTGCAGCAAGAGTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTGGTATCTGCAGGGTTTGCAACAAGGGTCCCAGAATTGTCCAGAAGTGAGCAGGTTCCAAGTCCTGTGTGAGATGTTAACACCTGTTGCATTTACCGTCCTTACACTGCTATCATGCCAATGAACTCCAGGAGGCTTTATTTGCAACTTGTGTAACACTTCCTGTTTTTTAGGTTTTACTGATCAGGCTTGTGAGCCACTCAAAATAATGTTTGTGATCCCTACTATTGATTCTGCCCTTGGAGCAAACTGAATAAAGCAACACAATGAAAACTGAGTACTCT