Transcript asmbl_39758

Sequence
Transcript Sequence for observation asmbl_39758 of TGE0005398:
CCTTCTCAAGGGCCCACTTTCGGAGTTAAAGGAGGAGCTGCGGGTGGCGGATATGCCCAGGTCATTCCCATGGAGGAGTTCAACCTTCACTTGACGGGGGACATTCATGCCATCACCGCTGCCAATAATTTGCTGGCTGCTGCCATCGACACAAGGATTTTGCATGAAAACACTCAAACTGATAAAGCTCTATATAATCGACTGGTTCCTTTAGTGAATGGTGTTCGAGAATTTTCAAAAATTCAACTTGCTCGGCTCAAAAAACTGGGAATAAATAAGACGGATCCAAGCACACTGACAGAAGAGGAAATGAGTAAATTCGCCCGTCTCAACATCGACCCCTCTACCATCACGTGGCAGAGAGTACTGGATACAAATGACCGGTTTCTACGAAAAATAACGATTGGGCAGGCAAACACAGAGAAGGGATGTTCCCGGCAGGCGCAGTTCGACATCGCGGTGGCCAGTGAGATCATGGCAGTACTGGCCCTGACCGATGGCCTCACAGACATGAAGGAGCGGCTGGGAAGAATGGTGGTGGCCAGTGACAAAAATGGGCAGCCCATAACCGCGGAAGATTTGGGGGTGACAGGTGCTTTGACAGTTTTGATGAAAGATGCGATAAAACCAAATCTGATGCAGACCCTAGAAGGCACACCCGTGTTTGTGCACGCCGGCCCCTTCGCAAACATCGCCCACGGCAACTCTTCGGTGTTGGCTGATAAAATCGCCCTGAAACTAGTTGGTGAAGAAGGATTCGTAGTGACTGAAGCTGGCTTCGGTGCCGACATTGGCATGGAGAAATTCTTCAACATCAAGTGTCGAGCTTCTGGCTTGGTGCCCAACGTAGTCGTGTTGGTGGCAACAGTGCGAGCTCTGAAGATGCACGGAGGCGGGCCAAGTGTAACTGCTGGCGTCCCTCTTAAGAAAGAATATACTGAGGAGAACATCCAGCTGGTGGCGGACGGCTGCTGTAACCTCCAGAAGCAGATTCAGATCGCTCAGCTCTTTGGGGTCCCCGTCGTCGTGGCTCTGAATGTCTTCAAGACCGACACCCGCGCCGAGATTGACTTAGTGTGTGAGCTTGCGAAGCGGGCTGGCGCCTTCGATGCTGTCCCCTGCCATCACTGGTCGATTGGTGGGAAAGGGTCAGTGGACCTGGCTTGGGCTGTGAGAGAAGCTGCAAGTAAGAGAAGTCGTTTTCAGTTCCTGTATGATGTTCAGCTTCCAATTGTGGAAAAGATAAGAACCATCGCCCAGGCTGTCTATGGAGCCAGAGATATCGAACTCTCTCCTGAGGCACAATCCAAAATTGATCGTTACACGCAACAGGGTTTTGGAAATCTGCCCATCTGCATGGCAAAGACCCACCTTTCTCTGTCTCACCAACCTGACAAGAAAGGTGTACCCAGGGATTTCATTTTACCCATTAGTGATGTCCGGGCCAGCATAGGCGCTGGGTTCATATACCCTTTGGTTGGGACGGTGAGTAACATTCTCCAGAAACGTTTCTCAGTCTGTGTTGTCACGCGACCTAAAATCCTTC