Transcript asmbl_39597

Sequence
Transcript Sequence for observation asmbl_39597 of TGE0005387:
GCATGATAGCGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAATTATGTACCAAATCTATGCATATTTTATATTGCATAGAATACATTTTTTTGTTGTTGTTTCTTAATTACATGTTTAAGATGTAGCAGTTGTTTTACAGCTTCTTTTGGTCTTTTTTTTGTTTGTTTTTTAAAGTAAGGATGTGTAATCTAAATTATTTTTTCTCTCTCGTGTGAGTATATTTATCCAGAAAGTAGAGAACTTGT