Transcript asmbl_45251

Sequence
Transcript Sequence for observation asmbl_45251 of TGE0001880:
CGGCGGTGGCGGAAGTGGAAGCAAGGCCGGAGCTTTGACCATAAAGCCCAAGGCGGCGGCGTTGGCGGCGGTGTTTGGGGCCGGGCAGCTCCGAGGAGCCTGCTGGAGCCGGAATCGGACGTCTCTGTTGCGGCCTGCGTTGTGTCTCCTCCTCCGTTGACCCTGCGCTTCAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTCTCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGACCAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTCCAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCAACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAACTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAGGCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGCAGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGAAGGGGCAGTGAGCACAGAGTCCTTCACAGACCAAGAACACACACGTAGGCCTTCAATATGCGTCCCTCCTCCTCCAAACAGACCAGAACGTGAGCTCTCACATCCAGCTGCCAAAAGAAACTCCACCGAACAGTTACCCAACACACACACATACACAAAACACACTCGTGCACACAAAAACACATACACACAACACACACACAGCAAGCAAACTCCAGCCTGTGCCTGTCAGGGCTCCTGGGGCAGCTGCCCGCCTCGTGGGCCCTGTGTATGGCAGGCATATGGCAGAGACCCTGGGTGCTCTGGGGTGCAGTGGGCATGGAAAGCTTACTCTTTTTGTCCACTGGAGAGTGAGAGAACTGTTCACAGTTCATCTGTGTCTAATTATCTGATTTTTTTTTTAACGGTCTTGTGGTCTTTTACCCCTCCCTCCTTGAAGGTCCTGTGGGAAGGCTGGTGCCCAGGCTCCGTTCTGAGCAGGCTGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGGAATTCCTGGATTGTGTGTTTAAGTCCTCTAACGCAGGCGTGCAAGGTGGAGGGTTGAACCCTGTCTGGATTACAGAGTGTTAGAGACTCAAGTTTGGAAGTCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCACAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCTGAAGGGAAAACTGAACTAGACAGTTCCCTTCTGTGTCTAAATTTTCCAAAAGGTTGATTTGCTTAATATAGTAGTGTATACAATGGATAAATTGCTGTTACTTCAAGAATTAAAATTCTCATTTTCTCCCTTTCTGTTTTTTTTCCTTATATTCAACACTTTATGATGCCCTTTTGTCACTATCCTACTCAAAGAGGAAAGGAGAACCCACCAGACCTGTCCCAGTGACTCTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTACCTGTAGGTTAGCAGACCCTCCTCCTTTCCCACCCACCCAAGTGTGGCCCAGCACTAACCCACCGTCTCTTGGGTTGAGCCCTGGCAGTTCTGTCCCTTCCCGAGGTCCTGCCCTGCATCATGGCTTGCTTCCTGGAGCACTTCCCCTTCAGAGGTCTACATTCTAGGGTGTAGGCTGAGTTCTTCTGTAAAGAGACGAACGTGATGCCAATAAAATTTAACAAGAACAAAGAACA