Transcript asmbl_45249

Sequence
Transcript Sequence for observation asmbl_45249 of TGE0037912:
GCCGTGCGCAGCGGCGTGTGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTGAAAATAAACAGCCGCTGCTTTGCGAGTCGCCTTCTTGGTTCTTCGTCCGAGTCTCCTCCGCTGTGGGCAGCTCAGACGCCGAAGCTCTAACTGCAGCTATGAGCAGCAACGAATGCTTCAAGTGTGGACGATCTGGCCACTGGGCCAGGGAGTGCCCTACTGGTGGAGGTCGGGGTCGTGGAATGAGAAGCCGCGGCAGAGGGTTCCAGTTTGTTTCCTCGTCTCTCCCTGACATCTGCTACCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTGCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAATTGTGGCAAGCCAGGCCATCTGGCTCGTGACTGTGACCACGCGGATGAGCAGAAGTGCTATTCTTGTGGTGAATTTGGACATATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAATTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCATCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCTGTTCCCAGGCCAGTGAGCTTTACTTGCAGTGTAAAAGGAGGAAAGGGGTGGAAAAAACCGAATTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTAATGAATGGGAAGAGTTCAGTCAGACCAGTAAGCCCTTCTGGGTTTGAGTGTGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGCATCTAAGCTTCCATAAATAACTTTAATTCTTAGCATAATGACGGCCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCGAGTAACATCTGCATCAGGCCCTCAGAATATACAGTTGAGTTGGGAGTAAACTGAAAAGACAAATGTGTTGAAGGCTATGCCAGGGAATCTGGCTCAAAGCCTAACACAGAAGCAGCTTCATCCCAGTGACGATGCTGGACGTACAGATGGTGATGGCAAAGGTGTAGAACACATTTTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCCGATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTTGACTAAAGTTCCTTTTGTTTGTTTTAAATTTTCATCAATGTATATAGAACAAAATACCATATTAAAGAGGGGAATGTGGAGGACTGAAA