Transcript asmbl_39575

Sequence
Transcript Sequence for observation asmbl_39575 of TGE0005379:
TCACTGCCTTTTCCCACTCTTTATACCTACCTCAAAACAAAAAGGTATTGTACCATTGTATTGTGGCATTGTCAACGGAGTCACTGAGCCATATGTTAACATTTCCTGTTATGTACCACTGAGGTGTTTCTTCAGTACCTCTGACAAGAGTATATTTTGATTGACTGCTTTATGTGCTTCTTTATTTTTTATAGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATAGTATGGCGTCCTAGAATGCTTTGTGTCAG