Transcript asmbl_39573

Sequence
Transcript Sequence for observation asmbl_39573 of TGE0005379:
CGCAGCTCCCATAGCGGTTACCTCCGCCGGAGACGGTTGGGAGAACCGTTGTGGGCAGGGCTCCACCAGTCAAGAGACTTCTTCCTTACGACTGGACCTCGCAAGCACCGCAGTCGGCGCTGCTGTCGCTCGACAGGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATAGTATGGCGTCCTAGAATGCTTTGTGTCAG