Transcript asmbl_39566

Sequence
Transcript Sequence for observation asmbl_39566 of TGE0005377:
TTAATGCTGACGGGTTTGAAATGGCTTCGGTGTTAGCTGTGACCCGATTCAGGTGAAGATCTGGTCTTCGCAGTTGCGGCGGCGGCGGCCGCGGAGTCGGAGTTCTTAACGTTCTATCGGATCCGCAGAAGGGCCAGGAGTGGCCGTTTTGGTAGCACGGCGTCCGCAGGCTGGCGACGATCGCTGCTGTAGAAGACAGACAAACGAAGGTTTTTTTCCCCTTTTCATCATGGCTCAGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCTCAGCCAGCTGCATTGGGTGTTCAGCAGCCATCACTCCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAGGCCTTACCACACAAACCCCAACAAACTATCAGTTAACTCAAACTGCAGCACTGCAGCAACAAGCTGCAGCTGCAGCAGCTGCATTGCAACAGCAATATTCACAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGTTACAGCAACCTCAGCAGACCCTTTTAACACAGCCAGCTGTTGCACTGCCTACAAGCCTTAGTCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACAGGCGTGGTTACAAAACTACACGATACATTTGGATTCGTGGATGAAGATGTATTCTTTCAACTTAGTGCCGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGGGTATTAGTTGAAGCTACGTATAATCCTAATATGCCTTTTAAGTGGAATGCACAAAGAATTCAAACACTACCAAATCAGAATCAGTCCCAAACCCAACCTTTACTGAAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTGGTGTTCAGGCTCAGCCTCAGCCCCAGTCACTGCTACAGGCACAGATTTCAGCAGCTTCTATTACACCACTGTTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAAGCTGGTTTATTGCAGCCTCCTGTCCGTATAGTTTCACAGCCACAACCGGCACGCCGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGTCGTGAAAGGGAGAGAGAAAGACGTAGATCCAGAGAAAGATCTCCTCAGAGAAAACGTTCCCGGGAGAGATCTCCTCGAAGAGAGAGAGAACGATCACCTCGGAGAGTTCGCCGTGTTGTTCCACGTTACACAGTTCAGTTTTCAAAGTTTTCTTTAGATTGTCCTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAACATGGCCATTCTTGATCCACCAGATGCTGACCACTTATACAGCGCAAAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCCATGGCCATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACCCAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGCACACAATGGTACCGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACAGGATGAAGAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTAAATGATCTCCGAAAGGAATTAGAAAGTCGAGCCCTTAGTTCCAAAGGGTTAAAATCCCAGTTAATAGCCCGCCTGACAAAACAACTTAAAGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGAGAAATCTGAAAAAGAAGATGAAGAGGAGGATGATAGGAAATCTGAAGATGATAAAGAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGCGTCGAGAAAGAAGATATATTTTGCCTGACGAACCAGCCATTATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTGTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAGGAAAAGGAAAAGAAAAGTAAAAAAGATGAGAGAAAAGATAAAAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGAAAGGAAGAAAGATGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCAGGATGAGTATGATCCAATGGAAGCTGAAGAAGCTGAGGATGAAGAAGATGATCGAGATGAGGAAGAAATAAACAAACGAGATGACAAAAGAGACATCAACAGGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAAAGAAGCTTCTTAATAAAGTAGTACTTCGTGAATCTTGCTTTTACCGTAAACTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCATTACATGAAGATATGCTAGGAAACAGGTTATTACTTCCAACACCAACAGTGAAACAGGAATCCAAGGATGTGGAAGAAAATGTTGGCCTGATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTACAGTTACTAGAAGAAAAAACAGATGAAGATGAAAAGACCATATTAAATTTGGAAAATTCCAACAAAAGCCTCTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGACAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAACTGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGAAGGATAATGTGAAGAGTGACAATAAAGATCAGAAATCCAAGGAGAATGGCGCAAGTGTATAATACACGTAGTGATGAGGAATGGTGTTAAATAATGTAATATAAAAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTATAAAGTTTTATGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTGAAATTATAAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAGTTTAATTGACAATAGTATTTAATTACCAAATGTCTTTTATTAAAATACC