Transcript asmbl_44525

Sequence
Transcript Sequence for observation asmbl_44525 of TGE0004149:
CGCGCATCCGTGCGCCGCCCGAGGCTGGCCTGAGGAGTCGGCGGCCATCTTGTTCTTCTCGTGGTTCCCAGTGGCGAGAGGAGGAGGAAGCCCGGAGCGGAGCGGGGCGGCTGGGGGGGGTGGACCCGCCGCGGCTGCTGCTGCCACCGCCGCCGCCGCCACCACCGCTCGTGGGGCTCGTGGCGTGAGGAAGGAGGACGAGTGAGACCCCGGGGCGAGCGGGCGGCGGCGCCGCTGCTGCTGCTGCTGCTGCGGGAGGGTCGGCGGCGGGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCAGGCAAGAATGTCCAGCTCCAGGAGAACGAGATCCGAGGACTCTGCCTGAAGTCTCGGGAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAACTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCAAGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGCGCCAGCATCAATAGGATCTACGGATTTTATGATGAGTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTACTGTGGCGAGTTTGACAATGCAGGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCCAACGCCACGAGACCTGTCACACCACCACGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCACTTGACACTGCCTGGTTGGGACTTGTAACATAGCGTTCATAACCTTCCTTTTTAAACTGTGATGTGCTGGTCAGCTTGCCCAGGTAGACCTGTCTGTCGGGCCCTCCTCCATTTGATTACTGCTGGCACTTGCTGGTTATAGCAGCAAGCCAAGCACTTCATTCTCAAGAGAGCATTTTGTTTTGAACCTCTGTTCCCTTTGTGGACAGCTCTGATGATGGTGTTAAGCTGTACACCCTGGCAGGTTATCCTGTCTGAGGAGAAAGTGTACAATTGATCTTTTTTTAATTTAGTATAAGTCATGAATAATGTAAATGCCTGTTTTCTTTAGGATATAAAGAGAGCCTTAGAGTGCGTGAGTCTCTACATGTAATTGTCATAAATGCATTCTGTTGATACAAACCACTGTGAACAATTTTTTTTCCAGTTTGTTTGAAAGGGACTGCTTTCCCTCATTGTCTTGTCATGTACAAACTAGTGTCTGCAGCTGTGGCAGCAGGAGTGACCTGCCTGCCGCCAGCCCTGCCCAGACTATCTGAAGCACACTCCTTCCCACTGCACATTTAATAATGATTAAAGCCATTCTTTTCAATGTCTGTGATTCCTTCCTAAAGCCAAAGTTTCTGTTGGACTGTATGGCACGCCCTGGGGATGAGGTGGCCAGGGCATCGAGGCTGCGTGCACAGGCCGCCTCCCTCCGTGGGGCCTCAGAAGCAGGTTATTTTAACTAGCAATAGTGGTATAGTGCTGAGTAAGCTATTAATGATGGAAGTTAATGACACTTTGTACAGTTCCCATATAGTCTATTCACTGAGTGATCTTTTTACAGTTGGATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAACACTGTCCTATACGAGTGACCGATAATGCTTTCTTTGGCTACATTCTTTATTCTGCGGTGACATTGAGGCTTATAAATCAAAAGGAACTAACTTGCCGTCCACCGGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAACTACGACCTGTTAAATGAATCTGTTTGCACAGATGCCCGTGTACAATGCCATGTGCTGAGAATGGTTTCAGACTTATTAAATGCAAGCTTGTTAA