Transcript asmbl_39496

Sequence
Transcript Sequence for observation asmbl_39496 of TGE0003333:
CGAAGAGTGGCTCTCTTTTCCTCCTTGGCTGCTTGAAGGCCTTCTGCCATCATGAATGACACAGTAACTATCCGGACCAGGAAGTTCATGACCAATAGGCTACTTCAACGGAAACAAATGGTCATCGATGTTCTTCATCCTGGAAAGGCAACAGTACCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCAGATGTCATTTTTGTATTTGGATTCCGAACCCATTTTGGTGGTGGCAAGACAACCGGCTTTGGCATGATTTATGATTCCTTGGACTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCAAGAAAACAGCGAAAGGAACGCAAGAACAGGATGAAGAAAGTTAGAGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGACAACAGAAGGAGTAAAGATTCGTCAGTGACTCTGGTGATCAGATTCTTCATGAGAGGATTAATAAACTAATAACTTTTATGTG