Transcript asmbl_40315

Sequence
Transcript Sequence for observation asmbl_40315 of TGE0037545:
CTCGGTGCCCGGCCTGGAGGACAGCGGTGTCGCGAGTCGGCGATCGGTGGTCCGCGGCAACGCCGAGAGGCCGTACGGGAACGCGGGCGCCGGAGCTCAGAGAAAGCAGAAGATACCACCATGCCTATACGTCGAGCCGTGAATTCTACCCGGGAAACTCCACCCAAAAGCAAACTTGCTGAAGGGGAGGAAGAAAAACCAGAAGAACAGGAGAATGAGACTCCACCTGCTACATCCAGTGAGGCAGAGCAGCCCAAGGGGGAGCCTGAGAGTGGAGAGAAGGAAGAGAACAACAACAAGTCTGCTGAGGAACCCAAAAAGGATGAGAAGGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAGACGATTCCTGCCTGGGCGACTCTCTCTGCCAGCCAGCTAGCCAGGGCCCAGAGACAAACCCCCATGGCTTCCTCCCCACGGCCCAAGATGGACGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGACTGGCGCCTCGGTGGTTGCGATTCGAAAGTACATCATTCATAAGTACCCGTCTCTGGGTCTGGAGAGAAGGGGCTATCTGCTCAAGCAAGCGCTGAAGAGAGAGTTAAACAGAGGAGTCATCAGACAGGTAAAAGGAAAAGGTGCATCTGGCAGTTTTGTTGTGGTCCAGAAATCAAAACCACCTCAGAAATCCAAAAACAGAAAGAAGGGCTCGGCTCTGGATCCAGAACCACAAGTAAAACTGGAAGATGTTCTCCCGTTGGCTTTTACTCGGCTCTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATACGTGTCTCAGTATTACCCTAAGCTCAGAGTGGACATCAGGCCCCAGTTGTTGAAGAATGCTCTGCAGCGAGCAGTAGAGAGAGGCCAGCTCGAGCAGATAACTGGCAAGGGTGCTTCGGGGACATTTCAGCTGAAGAAATCAGGGGAGAAGCCCCTGCTGGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAACGAGCCTAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGGCCAACTCTAACTATCAGATGCATTTGCTGAAAAAAACCCTGCAGAAATGTGAGAAGAACGGGTGGCTGGAGCAGATCTCTGGGAAGGGGTTCAGCGGCACCTTCCAGCTGTCCTTCCCCTACTACCCTAGCCCAGGAGTTCTATTTCCGAAGAAAGAATCCGGTGGCTCTGACGATGAAGATGAAGATGACGATGACGATGAATCATCAGAAGACTCTGAGGATGAGGAACCACCACCCAAGAGGAGCTTACAGAAGAAAACACCAGCCAAGTCCCAAGGGAAGACAGCCTCCATGAAGCAGAGAGGGTCGAAGCCTGCGCGGAAAGTCCCGGCTGCCCAGAGAGGGAAAGTGAGGCCGCTGCCTAAGAAAGCTCCACCCAAGGCCAAGACCCCTGCCAGGAAAGCCAGACCCTCTCCCTCAGTCATCAAGAAGCCTAGTGGGAGCTCCTCCAGAAAGCCCATAGCCAGTGCACGAAAGGAAGCGAAACTGCCCGGGAAGGGCAAATCTGCCATGAAGAAGTCTTTCAAGACAAAAAAGTAAATTTTATAGGGAAAAGGGTATCATGATTGAATTCAGAATCTTACTTTATAAGGTCAGTGTGCATTTGTTCTAGTTATAATGCTTTTAAATTGTACTTTTTCTTCCCATGTGAGCATTGTGGGAAGGAATGGACACAGAGCAGCGTAGACATTTGTGAGCTTCGGTGCTGTTCAGTGCCTGCTTCTTCATCACCTTAATTTCTGCCATAACCTGGACTTCGCTGACTGTGTGACTGCCCTGCTCCCTCTGTTCATCTTAGCCCCAGCCCTCGTCCTCTTTCTGTGATCCGATTGAGGATTTTTTCCTCCTTCAAGTTAATTTAAACAACTGCAGAGATGTGTTTGTAGAGCACTTAGAGGTCTGGGGCTGGAAGTCCAGACGGCGCAGGAGCAGTGTTGGGAAGGCTTTGCGTCCTGCCTGCAGACTTGCTAGAGCTGTGGTGATTAACCCTGGCTGTTGAATCACTCCACTGACCAGTCTCCAGCTTGAGTCGGGGACATGTTAACTTCGGAAAGAAGCCCCCGTCCCTGCCATCCCATAGATTCTGAAGGGCTCCTCTCCTCCGGTCACGCTGACCAACTGCCAAGCTCGCTTTGCTGCCCAGAGCACTGTCCCCTCACAGCAAGCACAAGTTGTCTGCACCACTTGGTTTCTGACTGAAGGGGAAGTACAGGACTACATGGAATCTGATTTCTGGTGTTGCTTATTACCAAAAATGACAGAATATTCTTGATCAAATGTCTAGATATATTTTTAATATTTGGGGCATGAGTTGTCCCTGTTTGAGAGTTCCCATTACTAATGTAGAAATGTTAAATGGTAAAACATAATTTGCTAAAATGACCAGTTTTCAGATTCACCTGTGCGTGTGCCCCCCACTCCCATCCCACCCTGTTCTTTCCATAGAACTTTTGATATCAGGCAAACGGTTTCCTTTTTGAGATATTTTAACAGAGAAGGGGTGGGGGAGAAGCAGATGAAGCTGTACTACCCAGCCCTCTTCTTGTTTGTATTTGTTTAGGGTTGTGAGGTTGTGTAAAATAGTACTAGCTTCTTACTTGAGAACTACAGTTTCTGCTTATCATTTATTCTTCCTTGTGGCACTTAATATTTTAATTGTCTTAAGCTTTTTGATGTATATATCCTCTGGCCCCTTACATGCTGCCAGAGGAGAAGGTGTTTGTTTGAGATTCATTCCACTTGAAGTGTCTCCTGGGATCCCCACAGCTGCGTATGGCTGGGAAATGGACTTAAGGCTTGGGCTTGAATTGGTGGCTCCTACCTGTGAGGTCCCATCGTGAGTCACTGGGATTTGTGTTGCATGGAAGGCAGTCTTTCCTGTTGTAAATCTTCCTTTTTTATGTACAAATATTTTGAAAAATATGAATAAACATGAACTTTTAAAAGCTGCTGAACTACAGCTTAGTGAAAA