Transcript asmbl_39390

Sequence
Transcript Sequence for observation asmbl_39390 of TGE0005343:
GTAGCAGCGGCGGCGGCTAGTCTCCGGCACCATGAGCGGCTTCAGCAGCGAGGAGCGCGCCGTGCCCTTCACCCTCGAGTACCGAGTCTTCCTAAAAAATGAAAACGGACAATATATATCTCCATTTCATGATATTCCAATTTATGCAGATAAGGATGCGTTCCACATGGTAGTTGAAGTACCACGCTGGTCCAATGCAAAAATGGAGATTGCTACAAAGGACCCTTTAAACCCAATTAAACAAGATGTGAAAAAAGGAAAACTTCGTTATGTTGCAAATTTGTTCCCTTATAAAGGATATATCTGGAACTATGGTGCCATCCCTCAGACTTGGGAATACCCAGGACACAATGACAAACACACTGGCTGTTGTGGCGATAACGACCCAATTGATGTGTGTGAAATTGGAAGCAAGGTATGTGCAAGAGGTGAAATAATCAGGGTGAAAGTTCTAGGCATATTGGCTATGATCGATGAAGGGGAAACTGACTGGAAAGTCATTGCCATTAATGTGGATGATCCTGATGCAGCCAATTATAATGATATTAATGATGTCAAGAGGCTGAAACCTGGCTACCTTGAAGCTACAGTGGACTGGTTTAGAAGGTACAAGGTTCCTGATGGAAAACCAGAGAACCAGTTTGCTTTCAATGCAGAATTTAAAGATAAGGACTTTGCAGTTGATATTATTAAAAGCACTCATGACCTTTGGAGAGCCTTAGTGACGAAGAAAATTGATGGAAAAGGAATCAGTTGCATGAACACCACAGTGTCTGAGAGCCCCTACAAGTGTGATCCTGAGGTGGCCAAAGCCATTGTGGATGCTTTACCACCACCATGTGAATCTGCCTGCACAGTACCAACAGATGTAGATAAGTGGTTCCATCACCAGAAAAACTAAGGAAATTTCTCTGGAATACAAGCTGATACTGCAGCATCCTATTCATCTGGGAGTATTAGATGCAAAAGTAGTGGCTTTTCAAAGCTTTGAATATACAGAACTAATCTAACAAAGCAAATTCTGCTGTGACCAATCCAGTATATTCAGCATGTTATCTAAAAGCATTTTTTCATATCAACTCAGATAACTCTTGGTACATGCTTAAATATCAAAGCAGTTGTAATTTAGAAGTCATTTGTGAATAAATGTGCAAGATAAGTACATATTGGATGTATATGTGTTAGAAATAAAATTATTTTGCTGAAA