Transcript asmbl_36952

Sequence
Transcript Sequence for observation asmbl_36952 of TGE0002736:
GTGCTTTATAAGCGCCCGGCGCCGTCCGGCCCCTCCTTTCTGAGCCCCGGCGGTGCGCGCTACGGAGCTCGGCCAGCCTGCTCCGTCCTGACTCACCGCTGTTCGCTCCTGCTGAGGAACAAGTCGGTCAGGAAGCCGCGCCTCAGCCATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGCTCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAATCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGTGGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGCAGATGCCTAAGACAACTGAATAAATCGTCTTAATGGTCAAA