Transcript asmbl_3445

Sequence
Transcript Sequence for observation asmbl_3445 of TGE0003685:
CAAGCCGCGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAGTCGGACCGGGCTGGGCTCGCTAAAGGAGAGGCACCGCGGAGGGGCAGGCCAGCGTCGCGTCGCGATCCGGGATGTCGAAGAACACGGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGACGAATATGACGAGAACAAGTTCGTGGACGAGGAGGACGGCGGCGATGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCGTGCCTACGGCAAGGAAACATGACAGCTGCTCTCCAGGCTGCTCTGAAAAACCCCCCTATTAACACAAAGAGCCAGGCAGTGAAGGACCGTGCAGGCAGCATCGTCTTGAAGGTGCTTATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTGCAGTCTCTGGACAAGAACGGTGTGGACCTCCTAATGAAGTATATTTATAAAGGCTTTGAGAGCCCATCTGACAACAGCAGTGCTGTGTTGCTCCAGTGGCATGAAAAGGCCCTTGCTGCTGGAGGAGTGGGGTCCATTGTTCGAGTTTTGACTGCAAGGAAAACCGTGTAGTCCAGCTGGAACTGGACACCGTTCACAGAAGTGGGAGTTGCTGGTATAAAGACCAAAACAACCAAATGGCACCGCTGCCCTGTGGGTAGCATCTGTTTCTCTCAGCTTTGCCTTCTTGCTTCCTTTTTCATATCTGTAAAGAAGAAAATTACATATCAGTTTCCTTTAATGAAAATTGAAATAATGTGGAGAAAATTTTGTCTCAGTGGGGATGTTTGACCCTTTCATAACCATGTCAATAATATGTATCACATTCTGTAATTTATATTCAAGTTTGATTGTGCAATTTCTAACTCTGTTGCCTGGTTTAAGGGTTTTACTTTATTTTTAACCAATACTGAGAGATGTGATCAAAGTTGAGGCCAGTTTCCTAACTCATTGCTGGTCAGGAAGTGATCTTTATTTTTAAAAATGAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCACACTTCCCTTATTTAAGCAAAATGTGTTTCCAGGGCAAGTAGTGGGTGAGCCCTACTACCAGTTTCCAGCCTTCTTTCCGCTTGCCTCCAGATGATGCTATAAGTGTAAGTGTGCTACTTCCTGTTAGCATCCAACTTTCATGGCCTCTCAATCTCTTTGTGGTGACCCAGGGTCCGGAGCAAGGAGTCTTGCTCTATATAAATGTATTTACACAATATAAGCGCCTCTTTGGCACAAACATCCCATTTCCTTCTGGTAATAAGGCTGCCTGGGGAAACAGTCCCAAGTCAGAGACAGGCCTCCAGCAGCCTCTGGATGAAATACTTTCATCAGAAATAAGGTAGCTGCCTTAGCCATTACACAAGTGTTCACTGGAACATTTCCCATGATTTCCCGAGGACGTCTTCAGTGTTCTTCAGGTAATGGGGATCTCAGAAGATTTGGTTCTGATCCAAAGACACAGTCTGTGTTTCAGCTCAGTGTTTTTAAGAAAGAAAAATGCCACATAGTAAAAGAAAAAAAGTGTTTACTTCGTTGGACAAACCAAATTGATTCTCAAAAAATGACCGGTGCTTGTAAAAAGTTATTACAAAGTAGTTCCGAAACCAACCACCTGAATGTGCGTGGCCGAGAGGGAATCAGCCTGCTTGTCTTTCCCTAAGATGCCAACTCCAGAGTCACTGACTGAGGTGAGAACCAGCGCAGAAACTCTATAAACTGCTGTTTTTGATACCTGCTCTTTTTGTTTTGTTCTGTTTTGTAAAATTATGATAAACTTCAGAAAATAAAATGTCAGTGTTGAATAA