Transcript asmbl_38192

Sequence
Transcript Sequence for observation asmbl_38192 of TGE0000454:
CTTGTGTCACTGTCTACATCAGTGATCGCTTTAGCCGTTATGTCTAATAACGAGAATACGGAAGACAGAGTCTTGACAATAAAAAAAAAAGATTCCTTTTCAAGTTCCGAAAAATTCCCTGTGTATCTCATCGCCCTTATCCAAGATGGCTGAAACAGAGTCGGTATCTGCTCTAGCTGCCGGAAATATGTGAGCCTCTATGGTCTAAAAGGCTCTTTCGCGGTGCGTTTCTGACGACTTCCGGCGGCTCTTCTCGCGGGTATTGGCTGTTGGCGGCGTTGTGGCTAAGCTCGTGTGCGGCGGCAGTGTCGGCGGCGGCTGCAGCGAAAGAGTTTGGCGCGATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAAGGCAGAACTTACGCTGACTATGAATCTGTGAATGAATGCATGGAAGGCGTTTGTAAAATGTATGAGGAACATCTGAAGAGAATGAATCCCAACAGCCCCTCTATCACGTATGATATCAGTCAGTTGTTTGATTTTATTGATGATCTGGCAGACCTCAGCTGCCTTGTTTACCGAGCTGATACCCAGACATACCAGCCTTATAACAAAGACTGGATTAAAGAGAAGATCTACGTGCTCCTTCGTCGGCAGGCCCAGCAGGCCGGGAAATAGTTGTATTGGAAGGGGATGGGAGTGGGGTGGAACACAGGTGTGTACAGCGTGCTGTAGTGGAAGTTTTGTATTATAGTAATCCTGTTTCCATTTTGGTACACTCTAGCCAGGATCGAATGTATTAGATGAAATGTGAGGATCTTGTTCAATCTGAAACCCCTGTCACCCCCTTTTTTTTCTTTCTTTCCTTTTTTTTACTTAAATATTTTTATGATTATTTAGATGGAAGTTGTTCTTTGTCAGATAATGTTGATTCCAATCCTTCAAAAACTCTTCATATCTGCTATATAACATTCACTGTACTAACCCTTCTTCAAGTTGAAGGGGGGGGTGGTGGCACAGGTTAGTTATGTCCTCAAGATACAGTCTAGTGAAAAACAAATAAATGTTCTTTAGTTAT