Transcript asmbl_38185

Sequence
Transcript Sequence for observation asmbl_38185 of TGE0005287:
TTTTCCCTGGACGTGTATTTGCATCTACTCCTCCTATGTTCCTCTTCCCTTTCTGACCCCAAAACCGTACACATCGTCCTCCCCTCCGGCCGTCTGTGCCCCCGTCTTCCTGGCCCTGGGCTGGCCCTTCTCCTCCTGTCTCTGGCCCTCCTTGTGTCTTGGTGCCACTGCCCCCACAGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTTATCTCCATGGGTTACAACATGGGAGAGGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAATCGCCTGGGGGTAGTGACATTCCAGGCCTTCATCGACTTTATGTCCCGTGAAACGGCCGACACGGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCAGGGGACAAGAACTACATCACGGTGGACGAGCTGCGCCGGGAGCTGCCGCCGGACCAGGCCGAGTACTGCATCGCGCGAATGGCCCCCTACACCGGCCCTGACGCCGTGCCCGGTGCTCTGGACTACATGTCCTTCTCCACAGCGCTCTACGGCGAGAGTGACCTCTAACCCGCCCCCACTCGTCCAGCGCCCTCGCCCCTGCCCGCGTGAGCCCCGCCCTGCACCTCCGCTGTACCCCCTCTCCTGCCCGGGTTTGGTTTCCACGCCCAGCCTCCAACCGGCCAGCTGGGACCCGCCGCGGCGCTGATCCTCCCTGCCCGCCAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAATTATGTTAAAAAAAGTAAAAAAAACCAAAAAACCGCATATTTTATTATAGAAAAAGTATTTTTTTCTCCACCAGACTTAAATGGAAAAGAGGAAAAATTAACTATTTGCACCGAAATGTTTCGTTTTGTTGTGACATAGGAAAATAACTAAGCACAATGTTATATTTCATCCTTTTTATCGACTTTTTTTTCTATCTGTCCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCGCCTTGATGTGGGAGTGGGGGGTGGGAGGTAGGGGATGATCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGATGTTTTTGCAAGGAAGAGGATTTATGTGGCTTGTCTCATTTTTAAGTTTAGAGGTGTGATTAGCCTCTTCATCCGTGCACTTTTTTTTAAACTATAACATTACCTATTAAAAATGGTCAGGACAAAATTGGAGTATGGGCAACTTTGATATTGCTTGGCACAGACCGTATT