Transcript asmbl_38128

Sequence
Transcript Sequence for observation asmbl_38128 of TGE0005280:
CCTGGCCTAATAAGAGGCACTCTTGGCAATCTTGTTTATAACATCACCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTTGTAGATGTGGACCACCAGGGGGTTGTTGAAAACTAATTGTATTAAATTGTCTTTTGATAAGCCTTCTTCTCACATTTTTGTGAATGTCTGAAGTATATAGTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCGAATTTAATTTTTTTGTACTAGCAAAAATTTGAACATTTTAGTGCCTGGTTATTCAAATATGTTAATTAAGAATTAGTTTAATGCCTCAATTAAACTAATTAATAGCTTTGGATACTTAAAAGAGCTCTAAATTTGCTTGTACATAGAGGCTTACTGAGTTTTCCTTGTTAGGGTCAAGGGTGTCCTCCCACCTACCCTTTAACAGCTGCTTGGCAAAGACGTTAAAGCAGCTGTTTGTTATTGATAATAAAAGATGATAAAACTGC