Transcript asmbl_29730

Sequence
Transcript Sequence for observation asmbl_29730 of TGE0006790:
GTTTGTGTGTGTGTATGTGTTGGTGACTGTGAGTACGGAGGAGCAGCGGCCGCCATTTCAGGGAGCTAGCCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCTGCCCTGCTCTCCGTCGCGGGCTCCTTTAATCCCATTGTTTCTTTTAGATTCGCTTGGGCCTAGACGCCCTCGGGGCCCGATATTCGGGTTGGGCGGTACCGCGGCCTGGGCCTAGTGGCTTAACAGTAGCGACAGCAGCAGCGGCGGCGGCGGCGGCAGCCGACTTCCCGTGGCGAGCACAGGCGCGCGGAAGCCCGCACAGGCGAGTAGAGAAAATGGCAGACGATATTGATATTGAAGCCATGCTTGAGGCCCCTTACAAGAAGGTGAGAAAACACGCTAGTGAGCTTTAATATATTTCTTAATTTAGCATTATTCACGAAACTACTGCTGAAATGTAAACTAACCTTCCCGGAGCCCTCTTGATTACCTTATCAGAGATGCAATACGTGTAACTTACAAAAGTAAATATATGCTATTGATGTAATAATATTGTGCAGTAGTTTCACTTCAGCGTGATGAATAAATGCCCATCTATCTCTCTTTGTAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGTAGTAATTGAGTGACTTATCGCTGTACCGTGGTCCCCTAGGTAAAATGACTCAACTAAGAATTACCAGCTCCAGTTTGGTATAGCAAAAAGGTGAATGTAGTGGTTTGGGAAAACTGCAGGGGTCCAAGAATAATAAATTACAACCAGTCTCTGGCAAGTAAATCTTAGAAGTCTTGAAAGAAGAAATGGGTGAGATTTAAATTTTATTTTATATAAATAGATATAAGACTGGTGATAGTAAACCTGAATACAGGCAGGTATTGATCTGCTTTTCAGTTAATAATTATTAAGATTCTTGGATCCCTGAATAGAAATTGGCAAAAAAGAGGAAAAAAAACCAAGAAAAAGAACAGAAGAGAGAAAAGAAAAAAAGCAAGAGACAGTATCACAGCTTAGAGTCACTTGATGACTGTTTTACTGCTCTCCATAGTGTTTATTTTTAATTAGGCCCTGCCATAGCTTTTCACACTCAAAACTAGAAAGGAAGTATTTTGGCCAGTAATACAATATGACCCATTTCGGTATCACAGTAAAAGTCAGCACTCTTCATTCTTTGACCAGTTGGTGGTGAAAATAGCAGTGTGCATGCATGCATTGTCACTGGTGTCTCAGACCTTAAGCCTGGTAACTTAGAGATCCTACTATTGGTGATGTGTTCAAACTGTGGAATAAAAACATTGCGCTTAAACCGTTTATAAATAATACATTTGTCTTGGAGTGTAGCACGACCATGTGGTGCCTTTTGGATGAATTCTGATAGCTTTAAATAGTGTAATTTTGTAATGCTAGACTCTTGAAGCCATACTTTCTGTTTTAATGTTTCTTGTCTTAGTTTAACTTGGATATAATTCCATGTAAACAGGTATGGAAGTAGGAAATGTTTAGGCTGGACTGGTGGATTATTAATTAACTTTTCTTGGGTTCTTGGGAGTCAACATTACTAAAGCAGTGTGAATCCCTGTTTGCTTCAGGGCGAGATGTGTGACAGAGGTGGCATCAAGCTCTTACAGTCCCAACCCTCCAACGGAAATGGGCGAAGATCTCAGGAATGGCATCGGTCACAGGAAATCGATAGTGGCTGGCTGCTAGCATGGCCACTTGGGGCTTAGGCAGAAATAGAGCCATGGTACCGACAAAAGGGACAATAGCACATGGAATAAAACTCAAAATGACTTCATGTTTCATAGAAATCTTTAACCACTTCAACATTGTAATTCCGGATGACTTATTTAATACTTAAACAATGTAAGAAAGTAAAATATAACATATTAAATGTGGAAAGATTTTAATTTTTGTTTCTTGATGACTTAATTATTAGCAACAAAGTGGTTAAACGTATACCATCTAAATTTTATAGCCTTCCATGTTAAAGTAAATAAGTAATTAGTTTTAAAATTGTCTTGTATTTTCTTATTCCTATTCCCTTTACCCTTTGACAACTTGAAATGTTACCACTTCGTCCTCATGATGTTCTTCTATCAACCTTGCTTAGGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGCCAC