Transcript asmbl_28636

Sequence
Transcript Sequence for observation asmbl_28636 of TGE0036808:
GGCCGGGTGGCGGCTGCACGTGCGGGCGGGGGCGATGCGTCACTGACCGGAGGAACAAGGATGAATATGACTCAAGCCCGGCTTCTGGTGGCTGCAGTGGTGGGGTTGGTGGCGATCCTCCTGTACGCCTCCATCCACAAGATCGAAGAGGGACACTTGGCCGTGTACTACAGGGGAGGAGCTTTGCTAACGAGCCCCAGTGGACCAGGCTATCATATCATGTTGCCTTTCATTACAACATTCAGATCTGTGCAGACAACACTACAAACGGATGAAGTTAAAAATGTGCCTTGTGGAACAAGTGGTGGAGTCATGATCTATATTGACCGAATAGAAGTGGTTAATATGTTGGCTCCTTATGCAGTGTTTGACATTGTGAGGAACTATACTGCAGACTACGACAAGACTTTAATCTTCAATAAAATCCACCATGAGCTGAACCAGTTTTGCAGTGCCCACACACTTCAAGAAGTTTACATAGAATTGTTTGATCAAATAGATGAAAACCTGAAGCAGGCCCTGCAAAAAGATTTAAACACCATGGCCCCAGGTCTCACTATCCAGGCTGTGCGTGTTACAAAACCCAAAATCCCAGAAGCCATAAGAAGAAATTTTGAATTAATGGAGGCAGAGAAGACAAAACTTCTCATAGCTGCACAGAAACAAAAGGTGGTGGAGAAAGAAGCTGAGACGGAGAGGAAAAGGGCTGTTATAGAAGCAGAGAAGATTGCACAAGTAGCAAAAATTCGATTTCAACAGAAAGTGATGGAGAAAGAAACTGAAAAACGCATTTCTGAGATTGAAGATGCTGCGTTCCTGGCCCGAGAGAAGGCAAAAGCAGATGCCGAGTATTACGCTGCACACAAATACGCCACCTCAAACAAGCACAAACTGACCCCAGAGTATCTGGAGCTCAAGAAATACCAGGCCATTGCCTCAAACAGTAAGATCTACTTTGGCAGCAACATCCCCAGCATGTTTGTGGACTCCTCCTGTGCTCTGAAATACTCTGATGGTAGGACTGGGAGAGAAGACTCCCTTCCCCCAGAGGAGGCCCGTGAGCCCTCTGGAGAGAGCCCCATCCAAAACAAGGAGAACGCAGGTTGATGCAAGAGGTGGAAATGTTCTCCCATATCAAGATGCGACCCAAGGGGCTAAGTGGGAACAGTGGTTATGTGGACTCGTAAGATTCACAGAGAATGTGTGCTCTGTTGTGATTCTCTTGTCATAGTCCTGGTTTGCCAGCTGACTACAGGATAGACCCAGCTGTCTGGCACTCAAACGGTCTCTGCAGCCACAGTTTTATCAAGTATCCTGTATGTGTTCCTTTGTAAACCGGTACTCATGAATGAGGGAAAGTCTGATGCTAAGATACTGCCTGCACTGGAATGTCAAACACTATATAACAAGCTGTGGTTTTTAAAAGCTATTGAATAATGTTTACATTGGTCCCTGAGGACATGTGTGCTCAGACATTCAAGAGCTAGGAGGCCAGAGAGAAGACCTTCAGAAAACGGTAAGTTAAAGAAGACAAGTGTCATCAGACACTTGGGACCCGGGCTCTCTTTAAAGTCTAGTCCCGGCATTCCTCCATGTGATTGACAGCCAGACCTCTGGGTTCCCAGGAAATTATCTTCCAGTTGAATGACCATTTACTTGATACAAATTGTACCTTTCTGTTTTTCTAGTCAGGTTGGTGGCCTGCAGGGACGCGTACTTTGCCACCCGACCAGAGGTTCCTCGAAGATATTCCCAATCACTAGTTTATTGCGTTAGGAGACTCAGAGATATAGAAAGCAGCTGAAATTTAAGGGAGATAAAGCCTGCACTGCACCAAAGCTACGGGTCCCTGTGTTTCCTCTATTCAGTGATGTCATCAACCTCACTGTCCCAGCCCATGTGTGACTAAAGTGCCCGGTTTTAGCCACAGACAACTGCTTAGATGTCACCTCTTGGCTGACCAAAGCTGGGACAGGGCTTTAACCAGACATAGGAGCAGTGTGCAATTCCTGATTCACTGCACAGTATTATGTCATAATTGCAGGAATTATTTTTTGTTTTTAAAACTGGATTTGGGGCACATTCATTCACCCCAACACTTCTATCTAAAGGCCAAGGTTCTAGGGCTGCTATGGTCACTAACACACTGATTCTCCTTAAAGTAATTCTCGAAGTGTGGAACAAAGTGACCGAGACAGCATCCTCAGTCATCTTTGTCTCCTTCCCTGGGATGCAGATACCGAAGTTGCTTTTCCAACTTTCGCCTCCGCTAGGAGATCAGAAAGAATTCTTGTGACTTCCTGGGCAGCCATTGAATTCATTTTCCATGAGAAGATGACAGAGTTAGCCTGTGGCTATAGGAGATCATGTCATCCAGACCTTTTTGCCCATCACATTAACTTTCCTGGAATATTGTGCTGCACAGGTAGACCTGAATCTGCCCAGCTTGTTGACAGCTCTTGTGTATACTGTGTTGAAGCCAGACAGAAAAGTAATGGGGCCACTTCTGAAACCTCTCAGCTGTTGATCTCACAGCAGCTAAAGGGTTGTGCCAAACATTTTATTAAGAAAGTAAAGCCCAGATTTGAATGGGGGTTTTCCCTAGGCCTTATAGTATAGAGGCATTTGTAATATGGAGAAAATAATTTTTCTCATTTAATTATAGAAATTACCTTCAAACAGATTTTGTGTTCTTTGGCCCTTCAAATACTGGTGTTACATTGTTGCTGCAGATAAATGATGATTGTCGTGGGATATCTGGATCACTGAGCTCTGTGCTTTCATTCCTAGAGATGTTTCTCATTCCCATTTAGTGAAATGCTGTTGCCCCAAAGTGATGGTTGTGGGATTTCTTACCGGTCATAGGCCCCGGTGAGGAGCAGGGAAGCGCCATTGTGAAAGATTAAAGAAAGCACTTCCACTTGAGCTCCTTATGGAGTGAGCTTCCCTGTGCCCACTCAGTGAACTAAGTCTGACCATCCTTCAGGGACGTTCCTTTTGGTAAATATACACTGTAATCTTTAAGTCTAAATTTATATGTGAAAGTTAACTTTTTTTAAAAACCTAAATAAAATTATTTTCCTATCA