Transcript asmbl_28358

Sequence
Transcript Sequence for observation asmbl_28358 of TGE0032877:
GGAGACGGGAGCGGGGTCCCGGGACTAGAAGAAACGGCGGCCGGGAGGGGGCTACGGGATCATGGGGCTTCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCGAGAGCTGCGGCTGCTCATGCTTGGCTTGGACAACGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAAGACGTGGACACCATCTCCCCGACACTGGGCTTCAACATCAAGACCCTGGAGCACCGCGGATTCAAGCTGAACATCTGGGATGTAGGTGGCCAGAAGTCTCTGCGCTCCTACTGGAGGAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCCGACCGCCAGCGCATGCAGGACTGTCAGCGAGAGCTGCAGAGCCTACTGGTGGAGGAGCGCCTGGCTGGAGCAACCCTCCTCATCTTTGCCAACAAGCAGGACCTGCCTGGAGCACTGTCCTGTAATGCTATTCAGGAGGCCCTGGAGCTGGACTCCATCCGCAGCCACCACTGGCGCATCCAGGGCTGCAGTGCTGTCACAGGGGAAGACCTGCTGCCTGGCATCGACTGGCTCCTTGATGACATTTCCAGTCGTGTCTTTACTGCCGACTGAGCTTCTTCAGTGTCCCCAGGTCCCTGTCCTCATCAGACACCAGCCAGAGGGATGAGCACCAGCTGGCCAGACTAACACTCCCAACCCCACCATGACCTGCTGCTGCTATTACTGCCCATTGCTGCTCCCCCGGGTGAGGGCTGTCACCCTGTCTCCCAAAGTGGCCTGCAGCTGCCATGCCAAAAGGAAAGGCTGGGCTGGGAGGGACTACCTGCTGCTGCCAGGGTCCTAGGTGTCGCCTCGCCTCGGTCCAGCAGTGAGAATAAAGCACTCTTCACCCAGTTCCTGGCTGAGCCATTTGTGAGTCACTGACTTTAGCACTCACCTGGAAGCTGAGTCCAG