Transcript asmbl_36762

Sequence
Transcript Sequence for observation asmbl_36762 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAGAATCTGTCACAGTGTTAAATTTTAAAAAATAATGTGAAGTATAATTTAAACTTAAGTATTAGCACATAGAATTATTTTCTGTGTCTTTATTGGTTATGTCACTGGGCTGCCAAAATAAGTCTATCCCTAAGTGCCAGATAATGTAATAGACTTTCAACATAAATAAATTTAGTCACAGGCACTGCTTTGCAAGTGTGGGTGACGATGCCACCCTACAGCTGGAAGATACTGGGGTTCAAGTTAACTTCCCTTGAGTGCTAGAAAGTGACAGTTGGGATGCCAGCCCAGGGCTTCCAGCCAGAAAAGCCATGTTCTTTCACTACATCCTGGTGTCAGTGTGTGTTTCACCGAAGGAAGTGAGAGCCGCGGGTGGTGGTGCATAGCGGCTGGGTGTTGTGTGAGAAAGAGGATTTGCAGTTCTTAGCTCTGAGATCTTTGCAGCGCATCTTTTTGAGTTCCAAACTCACGCTTTTTATTGAGCAGTAATCAAGATGTGTCATTAAAGCCATTTAGCCAAGATGAAGAAATGCATCCACAAGTGCATACTTTTCAGCCGCTGCAGCGGCACGATGGCAGTGTGACAGCGTCTCGCTGTGCACCAGTGCAGTCTGTACCAGCTGAGCCCGGGCCCCTATTCTGATA