Transcript asmbl_26360

Sequence
Transcript Sequence for observation asmbl_26360 of TGE0002143:
CGCCCGCCGCCTTCCACTCCGCCCCTGGCGGAGGAAGTGAGATCAGAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACGAGCATGATATCGCTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGACGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTCGGAGCCATCACATCTGTACAACAGAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTTTACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTTAACATTGACTTTGAACCTTTCAAACCAATTAATACATCATTGTATTTGTGCGACAATAAGTTTCATACAGAGGCTCTTACAGCGTTACTTTCAGATGACAGCAAGTTTGGTTTTATTGTAATAGACGGAAGTGGTGCTCTTTTTGGCACGCTCCAAGGAAACACCAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGCAGAGGAGGTCAATCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGAGACATAACTATGTTCGGAAAGTAGCCGAGACTGCTGTGCAGCTGTTTATTTCTGGAGACAAAGTGAATGTGGCTGGTTTGGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGACATGTTTGACCAGAGGTTGCAATCTAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAATTATCTACTGAAGTTCTCTCCAACGTGAAGTTCATTCAAGAGAAGAAATTAATAGGACGATATTTTGATGAAATTAGCCAGGACACAGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATACGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATTTAACTCCAGAACAAGAGAAGGATAAATCTCACTTCACAGACAAAGAGACTGGACAGGAACACGAACTGATAGAAAGCATGCCTCTCTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACACTAGAAATTGTCACAGATAAGTCACAAGAAGGATCACAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAGTACCAAGGAGGAGATGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAACCGTGCCTCACCCTCCAGCATTCAACCCAAGGAGCATACCCGTGGTGGAGTCCAACAGATCCCTGCCTTACAATTGGAGCATTTCCAGAACTTAATCCGTGAGCATTGGATACTGAAAAGAAAAGTGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCGTGGTGTCAGCGCAGCAGCCGACAACTAAGTCTCTAAAGGCCACTGTGGACTCATTTAAAAAGAATCCCAGTTTTTACTTTTACTTGATGGTAAAATTGGTTGCTCTTGTATTTTATGAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAGTAGACGTGAGGTCATACTGGTTTGTTTCTTCCTTTGATCGGAGAATAACTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCGGCTTAGACTGCACAAGAAGAAATATATGTGAAATATTGGAACTGTTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTGACAGGAGGCAGTTTGAGCTTCACTCCCTCACACTCCCCACTCCCAGACTGTCCCTTTCAAAGGTGCAGGTTGCGTTGTAAAGTCAGACTGAGTGCCAACACACTGGGGCCAGGGCACTCTGGGCAGTCACCAGTGTGGAGGCACAGTTGTGCCTGGCATTTGGGAGCCCTCTGTGCCATTAGCGTTACTGAGGCTCCCTGTCATCTCAGCCTACTAGAAACCAGTCTGGGATGGACATGATGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAACTTAAGTGGAACCAAAAAAAAATTCAAAGATGATTTTGCTTGGATCTATTCTTGGTAAGGGGAGGCGGTGGTGTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTATTTTTTTGTTTTCAAATGAACTGCAAGATTTTTTTCACGGGAACGACAGACACGACACGTATGACCGTGCATGTATCTCAAACCCCTGGTGGGGCTGGAGCATCTATTTCAAAAAGTGGGATCTACAAGCACCTCTCAGATGAGAAAGTATGGAGGCGGG