Transcript asmbl_367

Sequence
Transcript Sequence for observation asmbl_367 of TGE0005208:
AGGTAATTTTGTGTGTATTGGAGACCAGACCTGAAGCACTTCTGAATTTAAGATCCCCGATTCTTCGAGGCGGCATTGGACAGCGCTAAGATCAGAAGATGAGTGAACTTGACCAGTTACGGCAGGAGGCGGAGCAGCTTAAAAACCAAATCAGAGATGCTAGAAAAGCGTGTGCAGATGCAACTCTCTCTCAGATCACGAACAACATCGACCCAGTGGGAAGAATCCAGATGCGCACCAGGAGAACGCTGAGGGGGCACCTGGCCAAGATCTACGCCATGCACTGGGGCACGGACTCCAGGCTTCTCGTCAGTGCCTCCCAGGATGGCAAACTCATCATCTGGGACAGCTACACCACAAACAAGGTCCACGCCATCCCTCTGCGTTCCTCGTGGGTCATGACCTGTGCTTATGCCCCGTCTGGGAACTACGTGGCCTGCGGTGGCCTGGACAACATTTGCTCCATTTACAATCTGAAAACTCGAGAAGGGAATGTCCGCGTGAGTCGGGAGCTGGCCGGACACACAGGTTACCTGTCCTGCTGCCGCTTCCTGGACGACAATCAGATTGTCACCAGCTCTGGAGACACCACCTGTGCTCTGTGGGACATCGAGACCGGCCAGCAGACGACCACATTTACCGGGCATACCGGGGATGTTATGAGCCTCTCGCTCGCTCCTGACACCAGGCTGTTTGTCTCTGGTGCTTGCGATGCTTCAGCCAAACTCTGGGATGTGCGAGAAGGGGTGTGCCGGCAGACCTTCACCGGCCACGAGTCCGACATCAACGCCATCTGCTTCTTTCCAAATGGCAATGCGTTTGCCACTGGCTCGGATGATGCTACCTGCAGGCTGTTTGACCTCCGTGCGGACCAGGAGCTCATGACTTACTCCCATGACAACATCATCTGCGGGATCACCTCCGTCTCCTTCTCCAAGAGCGGGCGCCTCCTCCTCGCAGGGTACGACGACTTCAACTGCAACGTGTGGGACGCGCTCAAGGCCGACAGGGCAGGTGTCTTGGCTGGGCACGACAACCGCGTGAGCTGCCTGGGGGTGACTGATGACGGGATGGCTGTGGCCACGGGGTCCTGGGATAGCTTCCTCAAGATCTGGAACTAACGCCGACAGGTAACGAGCAGCCCAGGGGCCCTTCCCTGCAGGTGCCTCTGCGTCATTGTCCTAACACCTGAGGTGCGCGGTCGTGGTTTCCAGACCGAGTCTGAGGTAGAGCTGACGGGGAATCGTGGTAAGGTGAGCGTTTACCTCACCCCGAGCCGCGTGCCCTCGGCCGCACACCCAGGTGGAGCCGTAGAAGAACTGTAGCTGCGGTGACGGGCCTGAGCGTAGACACTGTTTCTTTTCACGTGTCTAACCTTTGTTTAAA