Transcript asmbl_22967

Sequence
Transcript Sequence for observation asmbl_22967 of TGE0036503:
CGGCGCGATGTTCGCATCCTGCTGCTGGGCGAGGCCCAGGTGGGGAAGACGTCTCTGATCCTGTCGCTGGTCGGCGAGGAGTTTCCCGAGGAGGTCCCTGCCCGCGCGGAGGAGATAACCATCCCCGCCGACGTCACCCCGGAGAAGGTGCCCACTCATATCGTGGATTACTCAGAAGCGGAGCAGACAGAGGAAGAACTTCAGGAGGAGATCCACAAGGCAAATGTAGTGTGTGTGGTGTACGATGTGTCTGAGGAGACCACCATTGAGAAGATCCGAACCAAGTGGATCCCGCTTGTGAATGGCAGGACGGCGACAGGGCCCAGGTTGCCCATCATCCTGGTGGGCAATAAGTCTGACCTGCGGCCGGGGAGTACCATGGAGGCTGTGCTGCCCATCATGAGCCAGTTTCCTGAGATAGAGACCTGCGTGGAGTGTTCAGCCAAGCACTTGAGGAATATCTCAGAGCTGTTCTACTATGCCCAGAAGGCTGTTCTGCATCCCACAGCCCCCCTTTATGACCCTGAGGCCAAACAGCTCAGGCCTGCATGCGCCCAGGCGCTCACACGCATCTTCAGGCTGTCGGACCAGGACCGAGACCACGGGCTGAGCGACGAGGAACTCAATGCCTTCCAGGTGTGGTCCTGCCCTGACACCCTAGCTGCCCTTGTGAGAGGGTCATCAGGATAGCTGACTGATCTGAAGCACTCTCT