Transcript asmbl_22963

Sequence
Transcript Sequence for observation asmbl_22963 of TGE0036499:
CGGCGCGATGTTCGCATCCTGCTGCTGGGCGAGGCCCAGGTGGGGAAGACGTCTCTGATCCTGTCGCTGGTCGGCGAGGAGTTTCCCGAGGAGGTCCCTGCCCGCGCGGAGGAGATAACCATCCCCGCCGACGTCACCCCGGAGAAGGTGCCCACTCATATCGTGGATTACTCAGAAGCGGAGCAGACAGAGGAAGAACTTCAGGAGGAGATCCACAAGGCAAATGTAGTGTGTGTGGTGTACGATGTGTCTGAGGAGACCACCATTGAGAAGATCCGAACCAAGTGGATCCCGCTTGTGAATGGCAGGACGGCGACAGGGCCCAGGTTGCCCATCATCCTGGTGGGCAATAAGTCTGACCTGCGGCCGGGGAGTACCATGGAGGCTGTGCTGCCCATCATGAGCCAGTTTCCTGAGATAGAGACCTGCGTGGAGTGTTCAGCCAAGCACTTGAGGAATATCTCAGAGCTGTTCTACTATGCCCAGAAGGCTGTTCTGCATCCCACAGCCCCCCTTTATGACCCTGAGGCCAAACAGCTCAGGCCTGCATGCGCCCAGGCGCTCACACGCATCTTCAGGCTGTCGGACCAGGACCGAGACCACGGGCTGAGCGACGAGGAACTCAATGCCTTCCAGAAGTCCTGCTTTGGCCATCCCCTGGCCCCACAGGCCCTGGAGGATGTGAAGAGGGTGGTGTGCAAGAACGTGTCAGGTGGTGTGCAGAATGACCGGCTGACCCTGGAAGGCTTCCTCTTCCTGAACACACTCTTCATCCAGCGTGGCCGGCACGAGACCACGTGGACCATCCTGCGGCGCTTTGGTTACAGTGACTCACTGGAGCTAACGCCCGACTACCTCTATCCAGCGCTCCATGTCCCCCCTGGCTGCAGCACAGAGCTCAACCATCGTGGCTACCAGTTTGTGCAGCGGATGTTCGAGAAGCATGACCAGGACCATGATGGTGTCCTCTCGCCCACGGAACTACAGAATCTCTTCAGTGTGTTCTCAGGTGCTCCATGGGGCCCTGAACTCTTACACACAGTCCCCACTCAGGCTGGCTGTCTGCCTTTGCATGGCTATCTCTGCCAGTGGACCCTCATGACCTACTTGGATGTCCAGCAATGCCTTGCACACCTTGGCTACCTGGGTTACCCTACCCTCTGTGAACAGGACTCTCAGGCACAGGCTATCACAGTTACCCGCGAGAAGAAGCTGGACCAGGAGAAAGGGCAGACACAGCGCAGCGTTCTCATGTGTAAGGTGCTGGGAGCCCGAGGAGTGGGCAAGTCAGCCTTCTTGCAAGCCTTCCTTGGCAACAGCCTTGGGGAAGCCAGGGACCCCCCTGAGAAATTCCCCCTGCATACCATCAATACAGTGCGGGTCAACGGGCAGGAGAAGTACCTGATTCTGTGTGAAGTGAATGCTGACAGCCTGCTGGACACCTCTCTAGACACTACCTGTGATGTCGCCTGCTTAATGTTTGACAGCAGTGATCCCAAGACCTTTGTACACTGTGCTACCATATACAAGCGTTATTACATGGATGGGCAGACCCCCTGCCTCTTTATTGCCTCCAAAGCTGATCTCCCTGAAGGTGTTGCCCCCCCAGGGCTGTCACCCGCTGAGTTCTGCCGGAGGCACCGGCTGCCTGCCCCAGCTTCATTCTCCTGCTTGGGACCCGCAATGCCCAGCACAGATGTCTTTACCCAACTTGCTACCATGGCCACTTTCCCACACCTGGTGCACACAGAGCTGCACCCCACCTCCTTCTGGCTCCGAGGAGTGCTGGTGGCTGTCGGCACGGCTGTGGCTGCTGTCCTTAGCTTCTCACTATACAGGGTCCTAGTGAAGAGCCGATGACAAAGGACCCATGAGCCTCTCCTGCCCCCAGGCACAGCACACTGTGGTGCCTTATGTGGGCCCACACGGCAAAGAAGTATGGGCTTTCGGCCTGTTGGAGTAATATCTGTGTGGCTGGCTACAGGGTCCCTGGGACTGATGTGGGTTCCTGCTCAGGAACTTGGTATTTAGATCTTGGCTTCCAAAAGTCTGTTGCCCTATTCCAGGCCTGTCCTGCTGAGCCTGAGAGTACTGGTGCCAGGTGTGAGGCCTTAGCCTTGGAGGGAGGGAGGATTGTGTGTAAGGGGCTGGGCTGTGGGTAAGGAATCCAGTGACCAGGACCCGAAGTTCTCAGGGTGTGTTCCCCCCCCTTCCTGGTTGTGCATGGCCAGTGGACATGTAGAGGGCAAGAGGTAGTGGTCAAATCAGGGAGGGACCCGATAGTCACAGAGGTCCCACCTTTTTGTCAGGTGTGGAGCCTTATCCACACTGCGCCAGCTGCAGAGCAAGCGGAACTGACTTTCCTGATTAAATTTCACTTGTCTTTTCCATCTCTTGGATTTTGATCTCTCAATGCAACTTACTTTCTCTCTTTCTCTCCCTCCCTTCCTTCCTTCCTTTCTTCCTTCTTCCTTTCTTCTT