Transcript asmbl_22441

Sequence
Transcript Sequence for observation asmbl_22441 of TGE0036442:
CCGGCGGGGGCTGCCCCGGGGAGTCAGTTGCGGCGGCGGGGAGCTCGGCGGAGGGCGGGCCGGGGCTCCGGGGCCATGCCGAGGAAGAAGCCCTTCAGCGTGAAGCAGAAGAAGAAGCAGCTGCAGGACAAGCGGGAGCGGAAGCGAGGGCTCCAAGATGGGCTGCGCTCCAGTTCCAACAGCCGCAGCGGTAGCCGGGAGCGGCGGGAGGAGCAGACGGACACGTCGGATGGGGAATCCGTGACCCATCATATCCGCAGGCTCAACCAGCAACCTTCCCAGGGCCTGGGGCCCAGAGGCTACGACCCCAACCGATACCGGCTGCATTTTGAACGGGACAGCCGGGAGGAGGTGGAGAGGAGAAAGAGAGCGGCCAGAGAGCAAGTGTTGCAGCCGGTCAGTGCTGAAGTGTTAGAGTTGGATATCCGGGAAGTGTATCAGCCTGGCTCAGTCCTGGACTTTCCCCGGCGGCCTCCTTGGAGTTATGAGATGTCCAAGGAACAGCTAATGAGCCAGGAGGAGCGGAGCTTCCAGGAATACCTTGGGAAGATACACGGGGCATACACTTCAGAGAAACTCAGCTACTTTGAGCACAATCTGGAGACATGGAGGCAGCTGTGGCGGGTGTTAGAGATGTCTGACATCGTCCTGCTCATTACTGACATCCGACATCCGGTTGTGAACTTCCCACCAGCACTTTACGAGTATGTAACTGGAGAGCTTGGGCTGGCCCTGGTGCTGGTCTTGAACAAGGTGGACCTGGCCCCGCCGGCTCTCGTGGTTGCCTGGAAGCATTATTTTCACCAGTGCTACCCCCAGCTCCACATTGTCTTGTTCACCTCTTTCCCTCGGGACACGCGCACTCCACAGGAGCCTGGTGGTGTCTTGAAGAAGAATCGGAGACGGGGGAAAGGATGGACTCGGGCACTGGGACCAGAGCAGTTGCTGAGAGCCTGTGAAGCTATCACTGTGGGGAAAGTGGACTTGAGCAGCTGGCGCGAGAAGATTGCTAGGGACGTGGCTGGAGCCTCCTGGGGTAACGTCTCCGGTGAGGAAGAGGAGGAGGAAGACGGGCCAGCAGTACTGGTAGAGCAGCTGACCGACTCAGCCATGGAGCCCACAGGCCCCTCCAGGGAGCGCTACAAGGATGGGGTGGTGACTATTGGCTGTATAGGTTTCCCCAATGTGGGGAAGTCCTCTCTGATCAACGGGCTGGTGGGGCGGAAGGTGGTGAGTGTCTCCAGAACGCCAGGCCACACCCGGTATTTTCAGACCTACTTTCTGACCCCCTCTGTGAAGCTCTGTGACTGCCCGGGCCTTATCTTCCCCTCGCTGCTGCCCAGGCAGCTGCAGGTTCTGGCTGGAATCTACCCCATTGCCCAGATCCAGGAGCCCTACACTTCTGTGGGCTACCTGGCCTCCAGAATCCCCGTGCAGGCCCTGCTGCACCTGCGCCACCCAGAGGCAGAGGACCCTTCGGCTGAGCACCCCTGGTGTGCCTGGGACATCTGTGAAGCTTGGGCAGAGAAACGTGGTTATAAAACGGCCAAGGCAGCTCGAAATGACGTGTACAGAGCGGCCAATAGCCTACTTCGCCTGGCAGTGGATGGCCGCCTCAGCCTATGTTTCTACCCTCCTGGTTACAGCGAACAGAGAGGCACCTGGGAGTCTCACCCAGAGACTGCAGAGCTGGTGCTGTCGCAGGGCAGGGTGGGGCCGGCAGGTGATGAGGAGGAGGAAGAGGAGGAGGAA