Transcript asmbl_19722

Sequence
Transcript Sequence for observation asmbl_19722 of TGE0000532:
GCGGGTGGAAGAAGATGGCGTCGGGTGGTGGTGGCTGTAGCGCTTCGGAGAGACTGCCTCCGCCCTTCCCCGGCCTGGAGCCGGAGTCCGAGGGGGCGGCCGGGGGATCAGAACCCGAGGCTGGGGACAGCGACACCGAGGGGGAGGACATTTTCACCGGCGCCGCGGTGGTCAGTAAACATCAGTCTCCAAAGATAACTACATCCCTTCTTCCCATCAACAATGGCTCCAAAGAAAATGGGATCCATGAAGAACAAGACCAAGAGCCACAGGATCTCTTTGCAGATGCCACAGTGGAGCTATCCTTGGACAGCACACAAAATAATCAGAAGAAGGTGCTAGCCAAAACACTCATTTCTCTTCCTCCTCAGGAAGCCACAAATTCTTCGAAGCCCCAGCCAACCTATGAGGAGCTAGAGGAAGAAGAACAGGAGGATCAATTTGATTTGACAGTCGGTATAACTGATCCTGAGAAGATAGGGGATGGTATGAATGCATATGTAGCCTACAAAGTTACAACACAGACAAGCTTACCATTGTTCAGAAGCAAACAGTTTGCAGTAAAAAGAAGATTTAGTGACTTTCTGGGTCTTTATGAGAAGCTTTCCGAGAAGCACTCTCAGAATGGCTTCATTGTCCCTCCGCCCCCGGAGAAGAGCCTCATAGGGATGACAAAAGTGAAAGTTGGGAAGGAAGATTCTTCTTCTGCAGAATTTCTTGAAAAACGGAGGGCCGCTTTAGAAAGGTACCTTCAGAGGATTGTAAATCATCCTACCATGTTACAGGACCCTGACGTCAGAGAGTTCTTGGAAAAAGAAGAGCTGCCACGTGCCGTGGGTACCCAGACATTGAGTGGTGCTGGTCTCCTCAAGATGTTCAACAAAGCCACAGATGCCGTCAGCAAAATGACCATCAAGATGAATGAATCAGACATTTGGTTTGAGGAGAAGCTCCAGGAGGTAGAGTGTGAGGAGCAGCGCTTACGGAAACTGCATGCTGTTGTAGAAACTCTAGTCAACCATAGGAAAGAGCTAGCGCTGAACACAGCCCAGTTTGCAAAGAGTCTAGCCATGCTTGGGAGCTCTGAGGACAACACGGCATTGTCACGGGCACTCTCCCAGCTGGCTGAGGTGGAAGAAAAAATTGAGCAGCTCCACCAGGAACAGGCCAACAATGACTTCTTCCTCCTTGCTGAGCTCCTGAGTGACTACATTCGCCTCCTGGCCATAGTCCGCGCTGCCTTCGACCAGCGCATGAAGACATGGCAGCGCTGGCAGGATGCCCAAGCCACACTGCAGAAGAAGCGGGAGGCCGAGGCTCGGCTGCTGTGGGCCAACAAGCCTGATAAGCTGCAGCAGGCCAAGGACGAGATCCTCGAGTGGGAGTCTCGGGTGACTCAATATGAAAGGGACTTCGAGAGGATTTCAACAGTGGTCCGAAAAGAAGTGATACGGTTTGAGAAAGAGAAATCCAAGGACTTCAAGAACCACGTGATCAAGTACCTTGAGACACTCCTTTACTCACAGCAGCAGCTGGCAAAGTACTGGGAAGCCTTCCTTCCTGAGGCAAAGGCCATCTCCTAATGGACCAAGGACCCCAGAGCCCACCTGTGTGACGCTGCCTTTTTATACACTGTCCTCCTCCACCTTGATGGACCCCTAGTGATGCATCCTGCCTAGGCTGGACTTAACCCCTTCCTCCCTGTCCCCACGACCAACTGTCCCCAGTTACTCTAACCGTTATTTCATTTAGCTTCCATATATATTTTCTTACCTAAGAGAATAGTTTCCTGCTTTAAGCAAAAGACCTACAATAGGTGGTGGAATTATGGGATGGGGTGGAGTATTGATATAAATATATAAATACAAATGTATATTTTTCAGGATGTGGTTTAGGAACTGGGAATAACGTTTTCTGTTACTCCTGATGGTGCCATGAAAAGGTTATGTAATAAAATATTTTAAAATCAGGTCACATGACTCAGAATGTTGGTGGTTTTTGCTTAGGCTGG