Transcript asmbl_22214

Sequence
Transcript Sequence for observation asmbl_22214 of TGE0003604:
GTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGTTGGCACCGCTCTAACCCCACCCAGCCCTCAGTGTTCCCGTGTGGCCTGGCCGCGCCCTAGGCGGGCACGGGGACACTGACGTGCCAGGGTAGTTCAGGAGCCCTGCTGCAGGCAGGCAGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTCGGCCGAGCCCGCCGCCTAGCCTGAGAAGCCAGGCTAGTGTTGCCCAGAGCTCCGGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA