Transcript asmbl_22212

Sequence
Transcript Sequence for observation asmbl_22212 of TGE0003604:
CGCAGCCATGAGGTAAGTTGTTATCGTGGCGCTATCCGCCGCCATCCGTGCACCCACACGCCCGCGGACGCCCCGCGGCCCGTCTCGGAGGCTCTCCCGGCGACTGCCCCGCGTCGCGAGCCTTTCCCCAGCGTGCCGTGGGCCTGTCATCGGGCCCGGGGTGCAGCATGGCCGGCCCCGAACGCCTTCGCTTCTCCCCAACAGCAGCAAAGTCTCACGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTGAGCGCGGGCCTCCCTCCCGGGGCAGGGCGAGCATCCCCGGCCATGGCGACCCTGGCTCACAGCTCCCCTCTCGCTCAGGTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA