Transcript asmbl_21926

Sequence
Transcript Sequence for observation asmbl_21926 of TGE0036402:
CCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATGAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAGATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGGCTGAAAGTATGGTGACAAGAATGTAGTTATTCCTAAATGGAATTATCTCTTAAAGTCAGTCTCTCTAGACTAACAGTAGAGGTTTGCCTATTTTTTCTTCTTCTTTGCTTTTTTGCAACAGGATTTCCATGTAGCCTTGTCCTCCATCAAGGCCAGACTAGACGTATGTATCAGCAAAACTTTGAAAGTATGTTTTATTTGTTGTAAAAACAATCAAGTTTATAATTAATCTAGAATTGAACACAATAAAAGTTAATATTATTTATTTTTAA