Transcript asmbl_36416

Sequence
Transcript Sequence for observation asmbl_36416 of TGE0005179:
GCGAAGGGCACAGATCTAAGGGCTCGGAGGACATTCGGCCTCTGTGAGCTGCAGCCTTTCCGAGGAGCGTCGTCTGTTCGCCATCTTAGGGAAGATGTTCTCGTCCGTGGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCTCACCTGCAGCTGGTGTACGATGGCCTCGCAGGCCCTTGCAGCAGCCCCTCCGGACCCCCGGGGCCCCCCCGCCGCTCCCGCAACTTGGCGGCCGCCGCTGTGGAAGAGTACAGTTGCGAATTTGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCTCTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAGAAGTACAAAGGCATATTTAATGGATTCTCAGTTACACTTAAAGAAGATGGTGTTCGAGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTACTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTCTTCAAAGTGTTGTATAGCAACATGCTTGGAGAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCCGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTCTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCATAAACGCATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGCGTTGTACAAGTTTGTGGTTCCTAAGCCCCGAAGTGAATGTTCAAAGGCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGCTGGAGTCTTTTGTGCAATCGTTTCTCACCCTGCTGATTCTGTGGTGTCTGTGCTGAATAAAGAGAAAGGTAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTAAAGGTGTATGGAAGGGACTCTTCGCCCGTATCATCATGATCGGCACGCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTTCCTCGCCCTCCTCCACCCGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGATTGACTCAGTAGATAGAGCAAAGCAAATATGGACTGAATCTGCTTGTTGGTCAGTGTTGAGGAAAGTGCTAAAGGAACTTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGAAATAATTACTGTAGTGCTCTTGCCTAAGGCAAGAGTTTCAAACTTGCTGTTGAAATAAACCCAACTGTTCATGA