Transcript asmbl_20461

Sequence
Transcript Sequence for observation asmbl_20461 of TGE0032373:
CGGTGCAGTGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGCCGCAGTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGCTTTCCAGGATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTGCTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTCTCCTGTGTCGCGCTTTAAAGTGGTTCCTCACATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGAGAAGTCATTTATATTCAGGAGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAATAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATTCAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTGAGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATGAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAGATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGGCTGAAAGTATGGTGACAAGAATGTAGTTATTCCTAAATGGAATTATCTCTTAAAGTCAGTCTCTCTAGACTAACAGTAGAGGTTTGCCTATTTTTTCTTCTTCTTTGCTTTTTTGCAACAGGATTTCCATGTAGCCTTGTCCTCCATCAAGGCCAGACTAGACGTATGTATCAGCAAAACTTTGAAAGTATGTTTTATTTGTTGTAAAAACAATCAAGTTTATAATTAATCTAGAATTGAACACAATAAAAGTTAATATTATTTATTTTTAA