Transcript asmbl_19817

Sequence
Transcript Sequence for observation asmbl_19817 of TGE0036304:
GCCCAGCCCGTCAGCCCGGCGACGCGCGCATGGAGGCCGGCTGAGGAGCGCCGCCGCCTCTCTCGGCATCCTACATCAATCAGGAAGCTGCTGTCCAGCCATGGAGGGAGAGGAGAAGCCAGCTCAAGAGGCTGACGTGGAACCTGTGGTAACAGCAGGCACCTCAGAAGCAGTGCCAAGGGTGCTTGCTGGAGACCCTCAGAACATCTCTGATGTGGATGCCTTCAACTTGCTCCTGGAGATGAAACTGAAACGACGGCGTGAACGCCCCAACCTTCCACGTACAGTGACCCAGCTAGTGGCCGAGGATGGGAGCAGGGTGTATGTGGTGGGCACTGCTCACTTCAGTGATGATAGCAAGAGAGATGTAGTAAAGACTATCCGGGAGGTGCAACCGGATGTGGTCGTGGTGGAGCTCTGTCAGTACCGGGTGTCCATGCTCAAGATGGACGAGAGGACGCTGCTGCGAGAGGCCAAGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCTGTCAGGCAGAATGGGCTTATGTCTGGACTCATGCAGATGTTGCTGCTGAAGGTGTCTGCTCACATCACTGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAAGAGGCCAGCAAGGTACCATTCTGCAAATTCCACCTGGGTGACCGACCAATCCCAGTCACCTTTAAGAGGGCCATTGCTGCACTCTCCTTCTGGCAGAAAGTCAAGCTGGCCTGGGGCCTGTGCTTCCTGTCAGACCCAATCAGCAAAGACGACGTGGAGCGCTGCAAACAGAAGGACCTGTTGGAGCAGATGATGGCCGAGATGATTGGGGAGTTTCCTGACCTGCATCGCACCATTGTCTCAGAGCGTGACGTCTATCTGACCTATATGCTGCGGCAGGCCGCACGGCGCCTTGAGCTTCCCCGCGCCTCTGATGCTGAGCCCAGGAAGTGTGTCCCGTCTGTGGTTGTGGGCGTCGTTGGCATGGGGCATGTGCCTGGCATTGAGAAGAACTGGAGTACCGACCTCAACATCCAGGAGATCATGACAGTCCCCCCACCGTCCATCTCAGGCAGAGTGTCCCGGGTGGCTGTGAAGGCGGCCTTCTTTGGTCTCCTGGGCTATAGCCTGTACTGGATGGGCCGTCGGACCCTGAACCTGGTCCTGTCACTGCCTGCTGCACAGTTCTGCCTCCAGAGGGTGAGCGAAGCCCGGCCAGGCCGGTAGGAGGACCGTGCAAGGAAGAGACTGCACCTGGGGGCTCTGCTCTGCGCCGAGTGGGGTGCTCACGAGGAGCTGGCGCCGCCCGTCTGGGGATGTCCCTGGGGACAGATGCATCCAAGCCACCCCCTATGGGGGCCTAGGCCAGGCTTTCCCTGCCTTCCCAATGCCCAGCCCACCCAAATAAAGAATATTTAACTGTCTGAGCCCAGGCTTCCCAGCAGCCCACACACACACTGTGGGGCCACCTATGGGCATCAGGGCCAACCGCAGTGTCAGGACCCAGCGGCCTAGTTCCAAAAGGACCAGAAACTGAGGGGGAGGCACTGAGACACCCCACCCTTAACCCCAGGTGGGTTTGGCAAGCTGTTGCTCTACCTACCTCACTGTGCCTTGTGCTCTGGCCGGCAGGAGCATCTGGGCCTGAGTGCATCTCACTGTGGGTTTGGGGCTGAGTGGCCATGCACCTCCCTCCTGGGTGTGTGGGGCCTGGCCTGGCCTGGACATGCATGTGGCATTGCCAGCTGCATCTCTGCCTGCAGAGAGTCTGGTTTTGTGGGGTTTTGTTTTCTGTTTTTGTTTTTGTTTTTTAATGTCAAAAAGTTTTTTACTCAGGTAATTTTGACGTCAAAGAGAAAACAAACTGAAGCAAATATCAGGAAATACAAGCCTTAAATCCAGTGAGGACAAAGAAGTCATCTTTTTATTTGTGTTTGTGTGCCCTGAGTGGGCAGTGTGTGTCAGAGTCGGCTTGGGGGTCCAGGCCAGCCCCTGCTAGACACCACTACAGCTCAGAGTGGCGTGGGGCTGCCTCAGATATGAGCCTGCAAGGCTGCCCTTGGTGTTGGTAGGACCTTAGCCTGATTGCTGTGCATTAGGTGAGAGGCCCAAACTGCACTGAGGGCAGTAGGCACCCACTATGGGCCACGGCTGGTTTGTGTGCAGCCAGCCATTCATGTGTACAGGCTGTGGCTCCTAGTATATGGCACAGCCTGGCAAGACCTAGACCACATTGATTGTCCTTGTGTTGGCTGCCAAATCAGGTGAGACACGGAGCTGGGTGGGGACACAGGGCTGGCTGGCTGTGTACTCTGTCTCACACTTGTGGACTCATTCCCTAGAAAGAAATAAATTTTAATTTTGGAA