Transcript asmbl_19693

Sequence
Transcript Sequence for observation asmbl_19693 of TGE0032301:
CACTTCTGGTGGCCCCCATCCTTGTCCTGACATGCAATTGGCTGAACTCCCGGGGAGGGGCGGGACTCACCGGGTCTGATCCAGTTAAAAAGGTCGGAGCGGGCCTGGGGCCCGTCTCTCGGGTGGAGTCTTCTGACTGCTGGTGGAGCAGGTCTCAGGAATCTCTTCGCTTCAGCTTCAATCATGGCCTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGGGAATGTCTCAAAGTTCGGGGAGAGGTGGCCTCGGACGCCAAGAGCTTTGTGCTGAACCTGGGAAAAGACAGCAACAACCTGTGCCTACACTTCAATCCTCGCTTCAATGCCCATGGAGACGCCAACACCATTGTGTGTAACACCAAGGAAGATGGGACCTGGGGAACCGAACACCGGGAACCTGCCTTCCCCTTCCAGCCCGGGAGCATCACAGAGGTGTGCATCACCTTTGACCAGGCTGACCTGACCATCAAGCTGCCAGACGGACATGAATTCAAGTTCCCCAACCGCCTCAACATGGAGGCCATCAACTACATGGCGGCGGATGGAGACTTCAAGATTAAGTGCGTGGCCTTTGAGTGAAGCCAGCCAGCCTGTAGCCCTCAATAAAGGCAGCTGCCTCTGCTCCCCATAATCCAGCCCTTTCATGGGAGAGTGTTTGTGTGTGTCTATGTGAGGGGCCCCGCCCAACCTGGTCCATCTTCACTTCCATTCATGCCTCCATGTGTTCTTGGTCTCAGTGACCTCTCTTGTGCTTTCCAGGCCAAAGAGAGCCCAGCACAGAGAGGGCTTAAGTGACCACAGAGGGTGAGCCAGTGTCCCACTGTGACAGGGACAGAGCAGTGGGAGGTGGATGGATGAACAGCCGGACCGCATTTGTCTTAATAAAAGCCAGAAACCACTGAG