Transcript asmbl_19088

Sequence
Transcript Sequence for observation asmbl_19088 of TGE0032245:
GTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGCAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTTGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGTGAGTGCTGGGGGCTGAGCCTTAGGATATATCTGGGACAGGACCTGCCATGCGTGCCTCTGCACAGCAACTAGCTGAGTCCACTAGGTGGGGTTGGTGAAAGATGTCAGAATCAGCTGTTCTGTGATGAGGCTCTGGAATGTGCGCTGGGCACAGCGCCCGAGAGAGACTGAGGAATTATTCCCTGTTGCCTTCCTTCTGAGAACAGCCCTGTTGATCTTAGTTGCCTCTGATACAGCTAACT