Transcript asmbl_19087

Sequence
Transcript Sequence for observation asmbl_19087 of TGE0036243:
GTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGCAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTTGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGGTGGCTTTGTGCATTATGGTGAGGTGACCAATGACTTCATCATGCTCAAAGGCTGTGTGGTGGGGACCAAGAAGCGAGTACTTACTCTTCGTAAGGTGAGACTGATCCTGGGCTCTAACCAGTCATTCTGGGCATGGGGGATCACAGGCCTTGAGCTATGCGGAAATTGGCCTGTCTGGGTATTGAAATCCTGGGGAAGGGTGGACTTTGCATTAGCCTTTTACCCACTCTGTTCTGTGTCAGTGTGGTGGCTGTTTGAGCGGGTGCTAAGTATTTGAACGCTGCTTGTCAGCTGCTAAGCATTCTTTTTGGCCCAT