Transcript asmbl_36277

Sequence
Transcript Sequence for observation asmbl_36277 of TGE0005159:
GTAAGAATGATGGGGAAAGTGACCAGAACACATTCGTTTCTCACCCAGAATTGGCTCCTTCTCCTTCCTAGAACACAGCCCTGGGCTGTGGGGGCCATGGAGTATTTGGGTTCCTTGGGGTTGGCTCAAGTCACTTTATCCCTTAATTTCTCCCAAAGGTGAGGAGGGAGGTTGAAGGGCAGGTGAGGAGCACTCTGTTTGGCCTTCACTCCCTTTTCCATGTTTCCAGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCC