Transcript asmbl_36276

Sequence
Transcript Sequence for observation asmbl_36276 of TGE0005158:
GGCCTCCGCGCCCTTGGGCTGGGACTCCACAGGCTGGCGGGAGGCTGGTCGCGTCACCCACGCCCCCGCCGCGCCCCGTTTCTATAAATTGCGAGCGCAGCCTCCCCCAGCGCTCTCTGCTCCTCCCGTTCTACAGACAGCCGCGTCCTCCTGCGCAGTGCCAGCCGCGACCCTGAGACACGATGGTGAAGGTTGGAGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGCAAAGTGGATATTGTCGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGATTCCACCCATGGCAAGTTCAAAGGCACAGTCAAGGCTGAGAATGGGAAGCTTGTCATCAATGGAAAGCCCATCACCATCTTCCAGGAGCGAGATCCCACCAACATCAAATGGGGTGATGCTGGTGCTGAATATGTTGTGGAGTCCACTGGTGTCTTCACTACCTTGGAGAAGGCTGGGGCTCACTTGAAGGGTGGAGCGAAGCGGGTCATCATTTCTGCTCCTTCTGCGGATGCCCCCATGTTTGTGATGGGTGTGAACCATGAGAAGTATGACAACTCCCTCAAGATTGTCAGTAATGCCTCCTGCACCACCAACTGCTTGGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGACTCATGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCC