Transcript asmbl_18749

Sequence
Transcript Sequence for observation asmbl_18749 of TGE0032183:
GAGCAGGAAGCGAGCCCGGCAGCCGCACTTTCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGGTATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAAGTTTCGGAAGAGCGATACAAACGAGTGGAACAAGAATGATGACCGTCTGCTGCAGGCTGTGGAGAACGGAGATGCTGAGAAGGTGGCCTCACTGCTGGGCAAGAAAGGGGCCAGCGCCACGAAGCATGACAGCGAGGGCAAGACCGCTTTCCACCTTGCCGCTGCGAAGGGACACGTGGAATGCCTCAAGGTCATGGTGACACACGGTGTGGATGTGACTGCCCAAGATTCTTCCGGTCACAGTGCTTTGCATGTCGCAGCCAAGAATGGCCACCCAGAGTGCATCAGGAAGCTTCTTCAGTACAAGAGCCCAGCGGAGAACATTGACAACTCGGGGAAAACAGCTTTGCATTATGCAGCGGCACAGGGATGCCTTCAGGCTGTACAGCTCCTCTGCGAACACAAGAGCCCCATAAACCTTAAAGACTTGGATGGGAACATCCCCCTGCTTGTTGCAGTCCAGAACGGCCACAGTGAGGCCTGCCACTTTCTCCTGGATCACGGCGCAGATGTCAATTCCAGAGACAAAAATGGAAGAACTGCTCTCATGCTGGCTTGTGAAACCGGCAGCTCGAACACTGTGGACGCCTTAATTAAAAAGGGAGCGGACCTGAGCCTTGTCGATTCTCTCGGACACAATGCCTTACATTATTCCAAACTCTCGGAAAATGCAGGAATTCAAAACCTTCTATTATCAAAAATCTCTCAGGATGCTGATTTAAAGACTCCAACAAAACCAAAGCAGGCTGAGATCAGCTCCATACAAGAAAACAAAGACAGGCTGAGCGACAGTACTGCAGGTGCTGACAGCTTGTTGGATATAAGTTCTGAAGCTGACCAACAAGATCTTCTTGTCCTGTTGCAAGCAAAAGTCGCTTCCCTTACCTTACACAATAAGGAGTTACAAGATAAATTGCAGGCCAAATCGCCCAAGGACAAGGAAGCGGAAGCCGACCTAAGCTTTCAGTCTTTCCATTCGACCCAGACTGACCTGGCCCCATCCCCGGGCAAAGCTAGTGACATCCCTTCCTCCGATGCCAAATCATCCCCACCCGTTGAGCATCCGGCGGGGACGTCCACCACTGACAATGATGTCATAATCCGGCAGCTCCAAGATTCCCTGCATGATCTGCAGAAGAGATTGGAGAGCTCCGAAGCAGAGAAGAAACAGCTCCAGGACGAACTCCAGTCACAAAGGACAGACACGCTTTGCTTGAACAACACAGAGATCTCCGAGAATGGCTCTGACCTCAGTCAGAAGCTCAAGGAAACCCAGAGCAAGTACGAAGAGGCCATGAAAGAAGTCCTGAGCGTGCAGAAACAGATGAAGCTGGGTCTCCTCTCCCAGGAGAGCGCCGATGGCTACTCGCATCTCCGGGAGGCGCCAGCTGACGAAGACATCGACACACTAAAGCAAGACCTGCAGAAAGCGGTGGAAGAAAGTGCAAGGAACAAGGAGCGGGTGCGGGAGTTAGAGACTAAGCTTGCGGAGAAGGAGCAGGCCGAAGCGACTAAGCCACCTGCCGAGGCGTGTGAGGAGCTGAGAAGTTCCTACTGCTCTGTTATCGAGAATATGAATAAGGAGAAGGCATTTTTGTTTGAGAAATATCAACAGGCCCAAGAAGAGATCATGAAACTGAAGGACACGCTAAAAAGTCAGATGCCACAGGAAGCCCCCGACGACTCTGGGGATATGAAAGAGGCCATGAACAGGATGATTGATGAACTCAATAAACAGGTGAGCGAGCTGTCACAGCTGTACCGAGAAGCCCAGGCAGAGCTGGAGGATTACAGGAAGAGGAAATCTCTGGAAGATGCAGCCGAGTACATTCACAAAGCTGAACACGAGAGGCTGATGCACGTGTCAAACCTGTCCAGGGCCAAGTCGGAAGAAGCGCTGTCGGAGATGAAGTCTCAGTATTCCAAAGTGTTGAACGAGTTGACTCAGCTCAAACAGCTGGTGGATGCACACAAAGAGAACTCCGTGTCCATCACAGAGCATTTGCAAGTGATAACCACGCTGCGGACAACGGCCAAAGAGATGGAAGAAAAGATAAGCGCCCTCACAGGGCACCTTGCAAACAAGGAAGCGGAAGTGGCAAAGCTGGAGAAGCAGCTCGCCGAAGAGAAGGCTGCCGTGAGCGACGCGATGGTCCCCAAGTCTTCCTACGAGAAGCTCCAGGCCTCCTTGGAGAGCGAAGTCAATGCCTTAGCAACAAAGTTAAAGGAGTCAGTAAGAGAGAGAGAGAAAGCCCATTCCGAGGTGGCCCAGGTTCGAAGTGAGGTCTCACAGGCGAGAAGGGAAAAGGACAACATCCAGACTCTCTTGAAAGCCAAAGAGCAGGAAGTAACTGCGCTTGTGCAGAAGTTCCAGCGAGCTCAGGAAGAACTGGCTGGGATGCGAAGATGCTCTGAGACCTCGTCGAAGCTGGAGGAGGATAAAGATGAAAAGATAAATGAAATGACCAGGGAAGTCCTGAAGCTGAAGGAGGCCCTGAACAGCCTCTCGCAGCTCTCCTACTCCACAAGTTCATCCAAGAGGCAGAGCCAGCAACTGGACCTGCTACAGCAGCAGGTCAAGCAGCTGCAGAACCAGCTGGCTGAATGTAAGAAACACCACCAGGAGGTCATCTCAGTTTACAGAATGCATCTTCTATATGCCGTTCAGGGCCAAATGGATGAAGATGTCCAGAAGGTCTTGAAGCAGATCCTCACCATGTGTAAAAACCAGTCTCAGAAGAAGTAAAAATGGATTCTTTGGCAGGACACTTGCCCCTCGTTGCCTCTCTTTGTGTTAGATCTGGGGTTGTCACTGACCACTGCCATTGTTCTTATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAAGATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAATCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGTGGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAATATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATTTAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATGAGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAACATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTGTATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAATTTTTTAAAAGTGTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGCCCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATGTAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAACCACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACACCTCAAACTCTAGCACCCACGAATGATTCCTGAAAGGGCTGTCAGTTCCAGTCAGCTTCTCCATGTTGAAAGTAAAAGTTCCAACATGGCACCGCGGTGCATAGCAGAAACCTCGGGGGAAATACGCCTACCGACCTTACTTTCAGGTTGAAAAGGTTCAACTTGCTTGCAGCTTCTCTTACAGCCCCCATGGTGAGGGAGATAAATGAAATAAAGGAACTTTGGGTGTGTTACTAAAGGTAGCGGTCTACTCTGACAGGACCCATCTGAGGCCACGTGGCTGAGTTGGGTCTGTTCATCTGTCTTAGGTAACGATCAATACCAGCATGAATTGGGTCTGTTCATCTGTCTTAGGTAATGATCAATACCAGCAAAACAAAAGTGGC